Transcription Factor Boltz Prediction Demonstration

Tom Goddard
September 4, 2025
Pacific Northwest Cryo-EM Center workshop

Predict binding of NTCA transcription factor to double stranded DNA using Boltz in ChimeraX.

• NTCA binds to a DNA promoter when nitrogen levels are low in cyanobacteria. Binding is enhanced 5-fold by 2-oxoglutarate binding to NTCA.
• Open NTCA dimer PDB 9gqu.
• Show Boltz user interface, menu Tools / Structure Prediction / Boltz.
• If Boltz not yet installed click "Install Boltz" button. Takes several minutes.
• Click "Add" button to add NTCA dimer #1. This will only use the sequence not the PDB structure.
• Choose "DNA sequence" paste CATTTTTATGTATCAGCTGATACATAAAAAT and press Add twice for two copies. Palindromic DNA binds to itself (note TTTTT at 5' end pairs with AAAAA and 3' end).
• Choose "ligand CCD code" and type AKG (code for 2-oxoglutarate).
• Under Options choose "Predict ligand binding affinity for AKG".
• Press predict. Takes 3.5 minutes on Mac Studio M2 Ultra.

Prediction colored by predicted local distance difference test (pLDDT) score. Blue means high confidence.	Log shows high confidence scores. "Confidence score 0.93, pTM 0.95, ipTM 0.95 (ligand 0.95, protein 0.96), pLDDT 0.93 Ligand AKG predicted binding affinity 7.3 uM, predicted binding probability 0.78"
Aligned to NTCA dimer, PDB 9gqu, monomers are further apart without DNA.	Aligned to NTCA dimer with DNA, PDB 9gui, prediction is very close.