Boltz DNA methylation example

Tom Goddard
September 4, 2025
Pacific Northwest Cryo-EM Center workshop

ChimeraX does not currently have a user interface to specify post-translational modifications of residues. Here is how to do make that modification and prediction by editing the Boltz input file.

We will methylate DNA residue cytosine 14 in the NTCA + DNA example.

• Run the Boltz NTCA and DNA prediction without methylation using prediction name ntca_dna.
• Outside ChimeraX, in a terminal on macOS, cd to the prediction directory.
  cd ~/Desktop/boltz/boltz_ntca_dna
• Look at the ntca_dna.yaml file in an editor
  open ntca_dna.yaml
• Look at the Boltz predictions input format documentation on the Boltz github site to see how to added a modified residue.
• Add the modification lines to the text file for residue position 14 with 3-letter code 5MC (5-methyl-cytosine).
• Save the file with a new name ntca_dna_methyl.yaml.
• Look at the command file that shows how the Boltz executable was run for the original prediction.
• Copy the command changing the input file name to the new ntca_dna_methyl.yaml and run it from the terminal.
• When it finishes (3.5 minutes on Mac Studio M2 Ultra), open prediction file
  boltz_results_ntca_dna_methyl/predictions/ntca_dna_methyl/ntca_dna_methylated_model_0.cif
  in ChimeraX.
• Can align to an existing structure with the matchmaker command
  mm #3 to #2
• Can show predicted aligned error with menu Tools / Structure Prediction / AlphaFold Error Plot, select the newly open structure.
• Can color by pLDDT by pressing the Color by pLDDT button on the PAE plot.

	version: 1 sequences: - protein: id: [A, B] sequence: MLANENSLLTMFRELGSGKLPLQIEQFERGKTIFFPGDPAERVYLLVKGA... msa: /Users/goddard/Downloads/ChimeraX/BoltzMSA/9guk_C/9guk_C_0.csv - dna: id: [C, D] sequence: CATTTTTATGTATCAGCTGATACATAAAAAT modifications: - position: 14 ccd: 5MC - ligand: id: [E] ccd: "AKG" properties: - affinity: binder: E
Boltz prediction input format.	Modified Boltz input file with added lines in yellow to methylate DNA residue 14.
Unmethylated prediction blue, methylated pink.