Opened 3 years ago
Closed 3 years ago
#10400 closed defect (fixed)
Histogram:`bins` must be positive
| Reported by: | Owned by: | Eric Pettersen | |
|---|---|---|---|
| Priority: | normal | Milestone: | |
| Component: | General Controls | Version: | |
| Keywords: | Cc: | ||
| Blocked By: | Blocking: | ||
| Notify when closed: | Platform: | all | |
| Project: | ChimeraX |
Description
The following bug report has been submitted:
Platform: Windows-10-10.0.22621
ChimeraX Version: 1.7 (2023-12-19 08:36:03 UTC)
Description
(Describe the actions that caused this problem to occur here)
Log:
UCSF ChimeraX version: 1.7 (2023-12-19)
© 2016-2023 Regents of the University of California. All rights reserved.
> open "D:\Mirror\My Ph.D. Data\Type III Phasevariable Mods PV SSRs\h cd-HIT
> est\80% ID DNA Cluster Analysis\ChimeraX\Catalytic Domain 7dsu_A and 4zcf_A
> align.cxs" format session
Log from Mon Dec 25 13:02:21 2023UCSF ChimeraX version: 1.7 (2023-12-19)
© 2016-2023 Regents of the University of California. All rights reserved.
How to cite UCSF ChimeraX
> open 4zcf
4zcf title:
Structural basis of asymmetric DNA methylation and ATP-triggered long-range
diffusion by EcoP15I [more info...]
Chain information for 4zcf #1
---
Chain | Description | UniProt
A B | Restriction endonuclease EcoP15I, modification subunit | Q5ZND1_ECOLX
1-644
C | Restriction endonuclease EcoP15I, restriction subunit | Q5ZND2_ECOLX 1-970
D | DNA 20-mer ATACAGCAGTAGACTATGAT |
E | DNA 20-mer AATCATAGTCTACTGCTGTA |
Non-standard residues in 4zcf #1
---
AMP — adenosine monophosphate
CA — calcium ion
MN — manganese (II) ion
> select /B:2-644
4705 atoms, 4798 bonds, 9 pseudobonds, 612 residues, 2 models selected
> delete sel
> delete solvent
> select /C:6-810
4452 atoms, 4518 bonds, 19 pseudobonds, 627 residues, 2 models selected
> delete sel
> select /D:1-20
413 atoms, 464 bonds, 20 residues, 1 model selected
> delete sel
> select /E:1-20
405 atoms, 453 bonds, 20 residues, 1 model selected
> delete sel
> select :AMP
23 atoms, 25 bonds, 1 residue, 1 model selected
> delete sel
> select :CA
1 atom, 1 residue, 1 model selected
> delete sel
> select :MN
2 atoms, 2 residues, 1 model selected
> delete sel
> select /A
4833 atoms, 4932 bonds, 8 pseudobonds, 616 residues, 2 models selected
> cartoon (#!1 & sel)
> surface hidePatches (#!1 & sel)
> show sel cartoons
> preset "overall look" "publication 1 (silhouettes)"
Using preset: Overall Look / Publication 1 (Silhouettes)
Preset expands to these ChimeraX commands:
set bg white
graphics silhouettes t
lighting depthCue f
> preset "overall look" "publication 2 (depth-cued)"
Using preset: Overall Look / Publication 2 (Depth-Cued)
Preset expands to these ChimeraX commands:
set bg white
graphics silhouettes f
lighting depthCue t
> preset "overall look" interactive
Using preset: Overall Look / Interactive
Preset expands to these ChimeraX commands:
~set bg
graphics silhouettes f
lighting depthCue t
> preset cartoons/nucleotides ribbons/slabs
Using preset: Cartoons/Nucleotides / Ribbons/Slabs
Changed 4833 atom styles
Preset expands to these ChimeraX commands:
show nucleic
hide protein|solvent|H
surf hide
style (protein|nucleic|solvent) & @@draw_mode=0 stick
cartoon
cartoon style modeh def arrows t arrowshelix f arrowscale 2 wid 2 thick 0.4 sides 12 div 20
cartoon style ~(nucleic|strand) x round
cartoon style (nucleic|strand) x rect
nucleotides tube/slab shape box
> select clear
> open 7dsu
7dsu title:
Structure of Mod subunit of the Type III restriction-modification enzyme
Mbo45V [more info...]
Chain information for 7dsu #2
---
Chain | Description
A B | Mbo45V
Non-standard residues in 7dsu #2
---
EDO — 1,2-ethanediol (ethylene glycol)
SFG — sinefungin (adenosyl-ornithine)
> select #2/B:12-548
3163 atoms, 3215 bonds, 4 pseudobonds, 420 residues, 2 models selected
> delete sel
> select :EDO
6 atoms, 5 bonds, 1 residue, 1 model selected
> delete sel
> select :SFG
54 atoms, 58 bonds, 2 residues, 1 model selected
> delete sel
> hide atoms
> matchmaker #2 to #1 showAlignment true
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker 4zcf, chain A (#1) with 7dsu, chain A (#2), sequence alignment
score = 527.4
Alignment identifier is 1
Showing consensus header ("seq_consensus" residue attribute) for alignment 1
Showing conservation header ("seq_conservation" residue attribute) for
alignment 1
Chains used in RMSD evaluation for alignment 1: 4zcf #1/A, 7dsu #2/A
Showing rmsd header ("seq_rmsd" residue attribute) for alignment 1
Hiding consensus header for alignment 1
Hiding conservation header for alignment 1
RMSD between 167 pruned atom pairs is 0.915 angstroms; (across all 343 pairs:
13.606)
> set bgColor white
> ui tool show "Render by Attribute"
> key blue-white-red :0 :2 :3 showTool true
> ui mousemode right "color key"
> key fontSize 12
> key numericLabelSpacing equal
> key size 0.24000,0.05000
> key size 0.25000,0.05000
> key size 0.25000,0.04000
> key size 0.25000,0.03000
> key size 0.25000,0.02000
> key size 0.25000,0.03000
> key size 0.25000,0.04000
> key size 0.25000,0.03000
> key pos 0.69000,0.08000
> key pos 0.68000,0.08000
> key pos 0.67000,0.08000
> key pos 0.66000,0.08000
> key pos 0.65000,0.08000
> key pos 0.64000,0.08000
> key pos 0.63000,0.08000
> key pos 0.62000,0.08000
> key pos 0.61000,0.08000
> key bold true
> ui mousemode right translate
> color byattribute r:seq_rmsd #!2 target absc palette 0,blue:2,white:3,red
> noValueColor springgreen
3073 atoms, 415 residues, atom seq_rmsd range 0.156 to 51.2
> color byattribute r:seq_rmsd #!2 target absc palette 0,blue:2,white:3,red
> noValueColor springgreen
3073 atoms, 415 residues, atom seq_rmsd range 0.156 to 51.2
> color #1 tan
> set bgColor black
> ui tool show "Color Key"
> ui mousemode right "color key"
> ui mousemode right translate
> ui mousemode right label
> label delete residues
> set bgColor white
> label delete residues
[Repeated 1 time(s)]
> ui mousemode right label
> label delete residues
> ui mousemode right label
> 2dlabels text "RMSD (Å)"
> label delete residues
> ui mousemode right label
> label delete residues
> ui mousemode right label
> ui mousemode right "move label"
> 2dlabels #4.1 xpos 0.672 ypos 0.134
[Repeated 3 time(s)]
> 2dlabels #4.1 xpos 0.653 ypos 0.121
> 2dlabels #4.1 xpos 0.681 ypos 0.121
> 2dlabels #4.1 xpos 0.671 ypos 0.129
[Repeated 1 time(s)]
> 2dlabels text 12
> 2dlabels #4.2 xpos 0.500 ypos 0.500
> 2dlabels delete
> 2dlabels"RMSD (Å)' 12 bold
incomplete quoted text
> 2dlabels"RMSD (Å)' 12
incomplete quoted text
> 2dlabels 'RMSD (Å)' 12 bold
Expected 'all' or a 2d label name or a label models specifier or a keyword
> 2dlabels 'RMSD (Å)' 12
Expected 'all' or a 2d label name or a label models specifier or a keyword
> 2dlabels 'RMSD (Å)' 12
Expected 'all' or a 2d label name or a label models specifier or a keyword
> 2dlabels text "RMSD (Å)" 12 bold
Expected a keyword
> 2dlabels text "RMSD (Å)" 12
Expected a keyword
> 2dlabels text "RMSD (Å)"
> 2dlabels #5.1 xpos 0.672 ypos 0.121
[Repeated 1 time(s)]
> 2dlabels #5.1 xpos 0.702 ypos 0.153
> delete 2dlabel text 'RMSD (Å)'
Missing or invalid "atoms" argument: invalid atoms specifier
> delete 2dlabel
Missing or invalid "atoms" argument: invalid atoms specifier
> 2dlabels delete
> color #1 tan
> set bgColor black
Drag select of 18 residues
> select clear
Drag select of 1028 residues, 11 pseudobonds
> select clear
Drag select of 1028 residues, 11 pseudobonds
> select clear
> ui tool show "Color Key"
> ui mousemode right "color key"
> key size 0.24000,0.03000
> key size 0.23000,0.03000
> key size 0.22000,0.03000
> key size 0.21000,0.03000
> key size 0.20000,0.03000
> key size 0.19000,0.03000
> key size 0.18000,0.03000
> key size 0.17000,0.03000
> ui mousemode right "move label"
> select #1/A:226 #2/A:212
19 atoms, 19 bonds, 2 residues, 2 models selected
> select #1/A:224 #2/A:210
15 atoms, 13 bonds, 2 residues, 2 models selected
> select #1/A:312
5 atoms, 4 bonds, 1 residue, 1 model selected
> select #1/A:256
6 atoms, 5 bonds, 1 residue, 1 model selected
> select #1/A:256-261 #2/A:255-260
102 atoms, 104 bonds, 12 residues, 2 models selected
MatchMaker Alignment [ID: 1] region 4zcf, chain A..7dsu, chain A [288-293]
RMSD: 18.478
> select clear
[Repeated 1 time(s)]
> select #2/A:260
5 atoms, 4 bonds, 1 residue, 1 model selected
> select #2/A:257-260
34 atoms, 34 bonds, 4 residues, 1 model selected
> select #1/A:53
5 atoms, 4 bonds, 1 residue, 1 model selected
> select #1/A:53-62 #2/A:51-60
148 atoms, 151 bonds, 20 residues, 2 models selected
MatchMaker Alignment [ID: 1] region 4zcf, chain A..7dsu, chain A [62-71] RMSD:
5.844
> view sel
> lighting soft
> lighting full
> lighting flat
> set bgColor white
> set bgColor #ffffff00
> select clear
> view
> lighting shadows true intensity 0.5
> lighting shadows false
> lighting flat
> graphics silhouettes false
> set bgColor black
> set bgColor transparent
> lighting flat
> graphics silhouettes false
> lighting flat
> set bgColor white
> set bgColor #ffffff00
> select #1/A:62
4 atoms, 3 bonds, 1 residue, 1 model selected
> select #1/A:62 #2/A:60
15 atoms, 14 bonds, 2 residues, 2 models selected
MatchMaker Alignment [ID: 1] region 4zcf, chain A..7dsu, chain A [71] RMSD:
3.811
> select #1/A:62,259-262 #2/A:60,258-260
72 atoms, 70 bonds, 9 residues, 2 models selected
MatchMaker Alignment [ID: 1] region 4zcf, chain A..7dsu, chain A [71] + 1
other block RMSD: 13.237
> select clear
> select #1/A:62-300 #2/A:60-260
3275 atoms, 3342 bonds, 2 pseudobonds, 416 residues, 4 models selected
MatchMaker Alignment [ID: 1] region 4zcf, chain A..7dsu, chain A [71] + 2
other blocks RMSD: 6.604
> select clear
> select #1/A:294
5 atoms, 4 bonds, 1 residue, 1 model selected
> select #1/A:62-300 #2/A:60-260
3275 atoms, 3342 bonds, 2 pseudobonds, 416 residues, 4 models selected
MatchMaker Alignment [ID: 1] region 4zcf, chain A..7dsu, chain A [71] + 3
other blocks RMSD: 7.571
> select #1/A:62-300 #2/A:60-260
3275 atoms, 3342 bonds, 2 pseudobonds, 416 residues, 4 models selected
MatchMaker Alignment [ID: 1] region 4zcf, chain A..7dsu, chain A [71] + 4
other blocks RMSD: 7.571
> select #1/A:62-300 #2/A:60-260
3275 atoms, 3342 bonds, 2 pseudobonds, 416 residues, 4 models selected
MatchMaker Alignment [ID: 1] region 4zcf, chain A..7dsu, chain A [71] + 5
other blocks RMSD: 7.571
> select clear
> select #1/A:62-300 #2/A:60-260
3275 atoms, 3342 bonds, 2 pseudobonds, 416 residues, 4 models selected
MatchMaker Alignment [ID: 1] region 4zcf, chain A..7dsu, chain A [71] + 6
other blocks RMSD: 7.004
Drag select of 1028 residues, 11 pseudobonds
> cartoon hide (#!1-2 & sel)
> lighting simple
> set bgColor black
> set bgColor transparent
> set bgColor white
> set bgColor #ffffff00
> lighting flat
> save "D:/Mirror/My Ph.D. Data/Type III Phasevariable Mods PV SSRs/h cd-HIT
> est/80% ID DNA Cluster Analysis/ChimeraX/Catalytic Domain 7dsu_A and 4zcf_A
> align.cxs"
——— End of log from Mon Dec 25 13:02:21 2023 ———
opened ChimeraX session
> show #!2 target m
> view #1 clip false
[Repeated 2 time(s)]
> select subtract #1.1
4628 atoms, 3342 bonds, 9 pseudobonds, 612 residues, 4 models selected
> select subtract #1.2
4628 atoms, 3342 bonds, 9 pseudobonds, 612 residues, 4 models selected
> close #1
> close #2
> close
> open 4zcf
4zcf title:
Structural basis of asymmetric DNA methylation and ATP-triggered long-range
diffusion by EcoP15I [more info...]
Chain information for 4zcf #1
---
Chain | Description | UniProt
A B | Restriction endonuclease EcoP15I, modification subunit | Q5ZND1_ECOLX
1-644
C | Restriction endonuclease EcoP15I, restriction subunit | Q5ZND2_ECOLX 1-970
D | DNA 20-mer ATACAGCAGTAGACTATGAT |
E | DNA 20-mer AATCATAGTCTACTGCTGTA |
Non-standard residues in 4zcf #1
---
AMP — adenosine monophosphate
CA — calcium ion
MN — manganese (II) ion
Associated 4zcf chain A to 4zcf, chain A with 0 mismatches
Associated 4zcf chain B to 4zcf, chain A with 0 mismatches
Drag select of 14929 atoms, 86 pseudobonds, 25 bonds
> preset "initial styles" cartoon
Using preset: Initial Styles / Cartoon
Preset implemented in Python; no expansion to individual ChimeraX commands
available.
> select /D
421 atoms, 464 bonds, 2 pseudobonds, 28 residues, 2 models selected
> delete sel
> select /E
410 atoms, 453 bonds, 25 residues, 1 model selected
> delete sel
> select /C
4479 atoms, 4543 bonds, 19 pseudobonds, 632 residues, 2 models selected
> delete sel
> select /B
4741 atoms, 4798 bonds, 9 pseudobonds, 648 residues, 2 models selected
> delete sel
Drag select of 15 atoms, 616 residues, 10 pseudobonds, 12 bonds
> hide (#!1 & sel) target a
> hide solvent
> open 7dsu
7dsu title:
Structure of Mod subunit of the Type III restriction-modification enzyme
Mbo45V [more info...]
Chain information for 7dsu #2
---
Chain | Description
A B | Mbo45V
Non-standard residues in 7dsu #2
---
EDO — 1,2-ethanediol (ethylene glycol)
SFG — sinefungin (adenosyl-ornithine)
Associated 7dsu chain A to 7dsu, chain A with 0 mismatches
Associated 7dsu chain B to 7dsu, chain A with 0 mismatches
> select #2/B
3199 atoms, 3249 bonds, 4 pseudobonds, 425 residues, 2 models selected
> delsel
Unknown command: delsel
> delete sel
Drag select of 1028 residues, 11 pseudobonds, 83 atoms, 77 bonds
> hide (#!1-2 & sel) target ab
> matchmaker #2 to #1 showAlignment true
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker 4zcf, chain A (#1) with 7dsu, chain A (#2), sequence alignment
score = 527.4
Alignment identifier is 2
Showing consensus header ("seq_consensus" residue attribute) for alignment 2
Showing conservation header ("seq_conservation" residue attribute) for
alignment 2
Chains used in RMSD evaluation for alignment 2: 4zcf #1/A, 7dsu #2/A
Showing rmsd header ("seq_rmsd" residue attribute) for alignment 2
Hiding consensus header for alignment 2
Hiding conservation header for alignment 2
RMSD between 167 pruned atom pairs is 0.915 angstroms; (across all 343 pairs:
13.606)
Chains used in RMSD evaluation for alignment 1: 4zcf #1/A, 7dsu #2/A
> lighting flat
> set bgColor white
> ui tool show "Render by Attribute"
Traceback (most recent call last):
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 768, in _set_value_cb
self._redraw_cb()
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 652, in _redraw_cb
filled_bins = self._bins(int(hist_width * filled_range / full_range))
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\render_by_attr\tool.py", line 345, in <lambda>
numpy.histogram(values, bins=num_bins, range=(min_val, max_val),
density=False)[0])
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\numpy\lib\histograms.py", line 780, in histogram
bin_edges, uniform_bins = _get_bin_edges(a, bins, range, weights)
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\numpy\lib\histograms.py", line 424, in _get_bin_edges
raise ValueError('`bins` must be positive, when an integer')
ValueError: `bins` must be positive, when an integer
ValueError: `bins` must be positive, when an integer
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\numpy\lib\histograms.py", line 424, in _get_bin_edges
raise ValueError('`bins` must be positive, when an integer')
See log for complete Python traceback.
Traceback (most recent call last):
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 179, in <lambda>
if event.modifiers() & mod_key_info("shift")[0] else
self._select_marker_cb(event)
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 723, in _select_marker_cb
self._set_sel_marker(marker, drag_start=event)
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 752, in _set_sel_marker
self._last_mouse_xy = self._abs_xy((drag_start.scenePos().x(),
drag_start.scenePos().y()))
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 441, in _abs_xy
num_bins = len(self._bins)
^^^^^^^^^^^^^^^
TypeError: object of type 'function' has no len()
TypeError: object of type 'function' has no len()
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 441, in _abs_xy
num_bins = len(self._bins)
^^^^^^^^^^^^^^^
See log for complete Python traceback.
Traceback (most recent call last):
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 180, in <lambda>
self._hist_scene.mouseMoveEvent = lambda event: self._move_marker_cb(event) \
^^^^^^^^^^^^^^^^^^^^^^^^^^^
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 576, in _move_marker_cb
mouse_xy = self._abs_xy((event.scenePos().x(), event.scenePos().y()))
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 441, in _abs_xy
num_bins = len(self._bins)
^^^^^^^^^^^^^^^
TypeError: object of type 'function' has no len()
TypeError: object of type 'function' has no len()
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 441, in _abs_xy
num_bins = len(self._bins)
^^^^^^^^^^^^^^^
See log for complete Python traceback.
Traceback (most recent call last):
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 179, in <lambda>
if event.modifiers() & mod_key_info("shift")[0] else
self._select_marker_cb(event)
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 723, in _select_marker_cb
self._set_sel_marker(marker, drag_start=event)
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 752, in _set_sel_marker
self._last_mouse_xy = self._abs_xy((drag_start.scenePos().x(),
drag_start.scenePos().y()))
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 441, in _abs_xy
num_bins = len(self._bins)
^^^^^^^^^^^^^^^
TypeError: object of type 'function' has no len()
TypeError: object of type 'function' has no len()
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 441, in _abs_xy
num_bins = len(self._bins)
^^^^^^^^^^^^^^^
See log for complete Python traceback.
Traceback (most recent call last):
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 180, in <lambda>
self._hist_scene.mouseMoveEvent = lambda event: self._move_marker_cb(event) \
^^^^^^^^^^^^^^^^^^^^^^^^^^^
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 576, in _move_marker_cb
mouse_xy = self._abs_xy((event.scenePos().x(), event.scenePos().y()))
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 441, in _abs_xy
num_bins = len(self._bins)
^^^^^^^^^^^^^^^
TypeError: object of type 'function' has no len()
TypeError: object of type 'function' has no len()
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 441, in _abs_xy
num_bins = len(self._bins)
^^^^^^^^^^^^^^^
See log for complete Python traceback.
Traceback (most recent call last):
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 769, in _set_value_cb
self._move_cur_marker(v)
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 570, in _move_cur_marker
self._active_markers._update_plot()
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 1231, in _update_plot
self._update_marker_coordinates()
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 1216, in
_update_marker_coordinates
x, y = self._scene_xy(m.xy)
^^^^^^^^^^^^^^^^^^^^
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 1099, in _scene_xy
return self.histogram._scene_xy(abs_xy)
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 512, in _scene_xy
num_bins = len(self._bins)
^^^^^^^^^^^^^^^
TypeError: object of type 'function' has no len()
TypeError: object of type 'function' has no len()
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 512, in _scene_xy
num_bins = len(self._bins)
^^^^^^^^^^^^^^^
See log for complete Python traceback.
OpenGL version: 3.3.0 NVIDIA 529.08
OpenGL renderer: Quadro P620/PCIe/SSE2
OpenGL vendor: NVIDIA Corporation
Python: 3.11.2
Locale: en_IN.cp1252
Qt version: PyQt6 6.3.1, Qt 6.3.1
Qt runtime version: 6.3.2
Qt platform: windows
Manufacturer: LENOVO
Model: 20TQS04M00
OS: Microsoft Windows 11 Pro (Build 22621)
Memory: 16,919,126,016
MaxProcessMemory: 137,438,953,344
CPU: 12 Intel(R) Core(TM) i7-10750H CPU @ 2.60GHz
OSLanguage: en-US
Installed Packages:
alabaster: 0.7.13
appdirs: 1.4.4
asttokens: 2.4.1
Babel: 2.14.0
backcall: 0.2.0
beautifulsoup4: 4.11.2
blockdiag: 3.0.0
blosc2: 2.0.0
build: 0.10.0
certifi: 2023.11.17
cftime: 1.6.3
charset-normalizer: 3.3.2
ChimeraX-AddCharge: 1.5.13
ChimeraX-AddH: 2.2.5
ChimeraX-AlignmentAlgorithms: 2.0.1
ChimeraX-AlignmentHdrs: 3.4.1
ChimeraX-AlignmentMatrices: 2.1
ChimeraX-Alignments: 2.12.1
ChimeraX-AlphaFold: 1.0
ChimeraX-AltlocExplorer: 1.1.1
ChimeraX-AmberInfo: 1.0
ChimeraX-Arrays: 1.1
ChimeraX-Atomic: 1.49.1
ChimeraX-AtomicLibrary: 12.1.3
ChimeraX-AtomSearch: 2.0.1
ChimeraX-AxesPlanes: 2.3.2
ChimeraX-BasicActions: 1.1.2
ChimeraX-BILD: 1.0
ChimeraX-BlastProtein: 2.1.2
ChimeraX-BondRot: 2.0.4
ChimeraX-BugReporter: 1.0.1
ChimeraX-BuildStructure: 2.10.5
ChimeraX-Bumps: 1.0
ChimeraX-BundleBuilder: 1.2.2
ChimeraX-ButtonPanel: 1.0.1
ChimeraX-CageBuilder: 1.0.1
ChimeraX-CellPack: 1.0
ChimeraX-Centroids: 1.3.2
ChimeraX-ChangeChains: 1.1
ChimeraX-CheckWaters: 1.3.2
ChimeraX-ChemGroup: 2.0.1
ChimeraX-Clashes: 2.2.4
ChimeraX-ColorActions: 1.0.3
ChimeraX-ColorGlobe: 1.0
ChimeraX-ColorKey: 1.5.5
ChimeraX-CommandLine: 1.2.5
ChimeraX-ConnectStructure: 2.0.1
ChimeraX-Contacts: 1.0.1
ChimeraX-Core: 1.7
ChimeraX-CoreFormats: 1.2
ChimeraX-coulombic: 1.4.2
ChimeraX-Crosslinks: 1.0
ChimeraX-Crystal: 1.0
ChimeraX-CrystalContacts: 1.0.1
ChimeraX-DataFormats: 1.2.3
ChimeraX-Dicom: 1.2
ChimeraX-DistMonitor: 1.4
ChimeraX-DockPrep: 1.1.3
ChimeraX-Dssp: 2.0
ChimeraX-EMDB-SFF: 1.0
ChimeraX-ESMFold: 1.0
ChimeraX-FileHistory: 1.0.1
ChimeraX-FunctionKey: 1.0.1
ChimeraX-Geometry: 1.3
ChimeraX-gltf: 1.0
ChimeraX-Graphics: 1.1.1
ChimeraX-Hbonds: 2.4
ChimeraX-Help: 1.2.2
ChimeraX-HKCage: 1.3
ChimeraX-IHM: 1.1
ChimeraX-ImageFormats: 1.2
ChimeraX-IMOD: 1.0
ChimeraX-IO: 1.0.1
ChimeraX-ItemsInspection: 1.0.1
ChimeraX-IUPAC: 1.0
ChimeraX-Label: 1.1.8
ChimeraX-ListInfo: 1.2.2
ChimeraX-Log: 1.1.6
ChimeraX-LookingGlass: 1.1
ChimeraX-Maestro: 1.9.1
ChimeraX-Map: 1.1.4
ChimeraX-MapData: 2.0
ChimeraX-MapEraser: 1.0.1
ChimeraX-MapFilter: 2.0.1
ChimeraX-MapFit: 2.0
ChimeraX-MapSeries: 2.1.1
ChimeraX-Markers: 1.0.1
ChimeraX-Mask: 1.0.2
ChimeraX-MatchMaker: 2.1.2
ChimeraX-MCopy: 1.0
ChimeraX-MDcrds: 2.6
ChimeraX-MedicalToolbar: 1.0.2
ChimeraX-Meeting: 1.0.1
ChimeraX-MLP: 1.1.1
ChimeraX-mmCIF: 2.12.1
ChimeraX-MMTF: 2.2
ChimeraX-Modeller: 1.5.13
ChimeraX-ModelPanel: 1.4
ChimeraX-ModelSeries: 1.0.1
ChimeraX-Mol2: 2.0.3
ChimeraX-Mole: 1.0
ChimeraX-Morph: 1.0.2
ChimeraX-MouseModes: 1.2
ChimeraX-Movie: 1.0
ChimeraX-Neuron: 1.0
ChimeraX-Nifti: 1.1
ChimeraX-NRRD: 1.1
ChimeraX-Nucleotides: 2.0.3
ChimeraX-OpenCommand: 1.13.1
ChimeraX-PDB: 2.7.3
ChimeraX-PDBBio: 1.0.1
ChimeraX-PDBLibrary: 1.0.3
ChimeraX-PDBMatrices: 1.0
ChimeraX-PickBlobs: 1.0.1
ChimeraX-Positions: 1.0
ChimeraX-PresetMgr: 1.1
ChimeraX-PubChem: 2.1
ChimeraX-ReadPbonds: 1.0.1
ChimeraX-Registration: 1.1.2
ChimeraX-RemoteControl: 1.0
ChimeraX-RenderByAttr: 1.1
ChimeraX-RenumberResidues: 1.1
ChimeraX-ResidueFit: 1.0.1
ChimeraX-RestServer: 1.2
ChimeraX-RNALayout: 1.0
ChimeraX-RotamerLibMgr: 4.0
ChimeraX-RotamerLibsDunbrack: 2.0
ChimeraX-RotamerLibsDynameomics: 2.0
ChimeraX-RotamerLibsRichardson: 2.0
ChimeraX-SaveCommand: 1.5.1
ChimeraX-SchemeMgr: 1.0
ChimeraX-SDF: 2.0.2
ChimeraX-Segger: 1.0
ChimeraX-Segment: 1.0.1
ChimeraX-SelInspector: 1.0
ChimeraX-SeqView: 2.11
ChimeraX-Shape: 1.0.1
ChimeraX-Shell: 1.0.1
ChimeraX-Shortcuts: 1.1.1
ChimeraX-ShowSequences: 1.0.2
ChimeraX-SideView: 1.0.1
ChimeraX-Smiles: 2.1.2
ChimeraX-SmoothLines: 1.0
ChimeraX-SpaceNavigator: 1.0
ChimeraX-StdCommands: 1.12.3
ChimeraX-STL: 1.0.1
ChimeraX-Storm: 1.0
ChimeraX-StructMeasure: 1.1.2
ChimeraX-Struts: 1.0.1
ChimeraX-Surface: 1.0.1
ChimeraX-SwapAA: 2.0.1
ChimeraX-SwapRes: 2.2.2
ChimeraX-TapeMeasure: 1.0
ChimeraX-TaskManager: 1.0
ChimeraX-Test: 1.0
ChimeraX-Toolbar: 1.1.2
ChimeraX-ToolshedUtils: 1.2.4
ChimeraX-Topography: 1.0
ChimeraX-ToQuest: 1.0
ChimeraX-Tug: 1.0.1
ChimeraX-UI: 1.33.2
ChimeraX-uniprot: 2.3
ChimeraX-UnitCell: 1.0.1
ChimeraX-ViewDockX: 1.3.2
ChimeraX-VIPERdb: 1.0
ChimeraX-Vive: 1.1
ChimeraX-VolumeMenu: 1.0.1
ChimeraX-vrml: 1.0
ChimeraX-VTK: 1.0
ChimeraX-WavefrontOBJ: 1.0
ChimeraX-WebCam: 1.0.2
ChimeraX-WebServices: 1.1.3
ChimeraX-Zone: 1.0.1
colorama: 0.4.6
comm: 0.2.0
comtypes: 1.1.14
contourpy: 1.2.0
cxservices: 1.2.2
cycler: 0.12.1
Cython: 0.29.33
debugpy: 1.8.0
decorator: 5.1.1
docutils: 0.19
executing: 2.0.1
filelock: 3.9.0
fonttools: 4.47.0
funcparserlib: 2.0.0a0
glfw: 2.6.4
grako: 3.16.5
h5py: 3.10.0
html2text: 2020.1.16
idna: 3.6
ihm: 0.38
imagecodecs: 2023.9.18
imagesize: 1.4.1
ipykernel: 6.23.2
ipython: 8.14.0
ipython-genutils: 0.2.0
ipywidgets: 8.1.1
jedi: 0.18.2
Jinja2: 3.1.2
jupyter-client: 8.2.0
jupyter-core: 5.5.1
jupyterlab-widgets: 3.0.9
kiwisolver: 1.4.5
line-profiler: 4.0.2
lxml: 4.9.2
lz4: 4.3.2
MarkupSafe: 2.1.3
matplotlib: 3.7.2
matplotlib-inline: 0.1.6
msgpack: 1.0.4
nest-asyncio: 1.5.8
netCDF4: 1.6.2
networkx: 3.1
nibabel: 5.0.1
nptyping: 2.5.0
numexpr: 2.8.8
numpy: 1.25.1
openvr: 1.23.701
packaging: 23.2
ParmEd: 3.4.3
parso: 0.8.3
pep517: 0.13.0
pickleshare: 0.7.5
Pillow: 10.0.1
pip: 23.0
pkginfo: 1.9.6
platformdirs: 4.1.0
prompt-toolkit: 3.0.43
psutil: 5.9.5
pure-eval: 0.2.2
py-cpuinfo: 9.0.0
pycollada: 0.7.2
pydicom: 2.3.0
Pygments: 2.16.1
pynrrd: 1.0.0
PyOpenGL: 3.1.7
PyOpenGL-accelerate: 3.1.7
pyopenxr: 1.0.2801
pyparsing: 3.0.9
pyproject-hooks: 1.0.0
PyQt6-commercial: 6.3.1
PyQt6-Qt6: 6.3.2
PyQt6-sip: 13.4.0
PyQt6-WebEngine-commercial: 6.3.1
PyQt6-WebEngine-Qt6: 6.3.2
python-dateutil: 2.8.2
pytz: 2023.3.post1
pywin32: 305
pyzmq: 25.1.2
qtconsole: 5.4.3
QtPy: 2.4.1
RandomWords: 0.4.0
requests: 2.31.0
scipy: 1.11.1
setuptools: 67.4.0
sfftk-rw: 0.7.3
six: 1.16.0
snowballstemmer: 2.2.0
sortedcontainers: 2.4.0
soupsieve: 2.5
sphinx: 6.1.3
sphinx-autodoc-typehints: 1.22
sphinxcontrib-applehelp: 1.0.7
sphinxcontrib-blockdiag: 3.0.0
sphinxcontrib-devhelp: 1.0.5
sphinxcontrib-htmlhelp: 2.0.4
sphinxcontrib-jsmath: 1.0.1
sphinxcontrib-qthelp: 1.0.6
sphinxcontrib-serializinghtml: 1.1.9
stack-data: 0.6.3
superqt: 0.5.0
tables: 3.8.0
tcia-utils: 1.5.1
tifffile: 2023.7.18
tinyarray: 1.2.4
tomli: 2.0.1
tornado: 6.4
traitlets: 5.9.0
typing-extensions: 4.9.0
tzdata: 2023.3
urllib3: 2.1.0
wcwidth: 0.2.12
webcolors: 1.12
wheel: 0.38.4
wheel-filename: 1.4.1
widgetsnbextension: 4.0.9
WMI: 1.5.1
Change History (2)
comment:1 by , 3 years ago
| Component: | Unassigned → General Controls |
|---|---|
| Owner: | set to |
| Platform: | → all |
| Project: | → ChimeraX |
| Status: | new → accepted |
| Summary: | ChimeraX bug report submission → Histogram:`bins` must be positive |
comment:2 by , 3 years ago
| Resolution: | → fixed |
|---|---|
| Status: | accepted → closed |
Note:
See TracTickets
for help on using tickets.
Fix: https://github.com/RBVI/ChimeraX/commit/06173216fab34b72745edda9363872d7336398c3