Opened 3 years ago

Closed 3 years ago

#10400 closed defect (fixed)

Histogram:`bins` must be positive

Reported by: chimerax-bug-report@… Owned by: Eric Pettersen
Priority: normal Milestone:
Component: General Controls Version:
Keywords: Cc:
Blocked By: Blocking:
Notify when closed: Platform: all
Project: ChimeraX

Description

The following bug report has been submitted:
Platform:        Windows-10-10.0.22621
ChimeraX Version: 1.7 (2023-12-19 08:36:03 UTC)
Description
(Describe the actions that caused this problem to occur here)

Log:
UCSF ChimeraX version: 1.7 (2023-12-19)  
© 2016-2023 Regents of the University of California. All rights reserved.  

> open "D:\Mirror\My Ph.D. Data\Type III Phasevariable Mods PV SSRs\h cd-HIT
> est\80% ID DNA Cluster Analysis\ChimeraX\Catalytic Domain 7dsu_A and 4zcf_A
> align.cxs" format session

Log from Mon Dec 25 13:02:21 2023UCSF ChimeraX version: 1.7 (2023-12-19)  
© 2016-2023 Regents of the University of California. All rights reserved.  
How to cite UCSF ChimeraX  

> open 4zcf

4zcf title:  
Structural basis of asymmetric DNA methylation and ATP-triggered long-range
diffusion by EcoP15I [more info...]  
  
Chain information for 4zcf #1  
---  
Chain | Description | UniProt  
A B | Restriction endonuclease EcoP15I, modification subunit | Q5ZND1_ECOLX
1-644  
C | Restriction endonuclease EcoP15I, restriction subunit | Q5ZND2_ECOLX 1-970  
D | DNA 20-mer ATACAGCAGTAGACTATGAT |  
E | DNA 20-mer AATCATAGTCTACTGCTGTA |  
  
Non-standard residues in 4zcf #1  
---  
AMP — adenosine monophosphate  
CA — calcium ion  
MN — manganese (II) ion  
  

> select /B:2-644

4705 atoms, 4798 bonds, 9 pseudobonds, 612 residues, 2 models selected  

> delete sel

> delete solvent

> select /C:6-810

4452 atoms, 4518 bonds, 19 pseudobonds, 627 residues, 2 models selected  

> delete sel

> select /D:1-20

413 atoms, 464 bonds, 20 residues, 1 model selected  

> delete sel

> select /E:1-20

405 atoms, 453 bonds, 20 residues, 1 model selected  

> delete sel

> select :AMP

23 atoms, 25 bonds, 1 residue, 1 model selected  

> delete sel

> select :CA

1 atom, 1 residue, 1 model selected  

> delete sel

> select :MN

2 atoms, 2 residues, 1 model selected  

> delete sel

> select /A

4833 atoms, 4932 bonds, 8 pseudobonds, 616 residues, 2 models selected  

> cartoon (#!1 & sel)

> surface hidePatches (#!1 & sel)

> show sel cartoons

> preset "overall look" "publication 1 (silhouettes)"

Using preset: Overall Look / Publication 1 (Silhouettes)  
Preset expands to these ChimeraX commands:

    
    
    set bg white
    graphics silhouettes t
    lighting depthCue f

  

> preset "overall look" "publication 2 (depth-cued)"

Using preset: Overall Look / Publication 2 (Depth-Cued)  
Preset expands to these ChimeraX commands:

    
    
    set bg white
    graphics silhouettes f
    lighting depthCue t

  

> preset "overall look" interactive

Using preset: Overall Look / Interactive  
Preset expands to these ChimeraX commands:

    
    
    ~set bg
    graphics silhouettes f
    lighting depthCue t

  

> preset cartoons/nucleotides ribbons/slabs

Using preset: Cartoons/Nucleotides / Ribbons/Slabs  
Changed 4833 atom styles  
Preset expands to these ChimeraX commands:

    
    
    show nucleic
    hide protein|solvent|H
    surf hide
    style (protein|nucleic|solvent) & @@draw_mode=0 stick
    cartoon
    cartoon style modeh def arrows t arrowshelix f arrowscale 2 wid 2 thick 0.4 sides 12 div 20
    cartoon style ~(nucleic|strand) x round
    cartoon style (nucleic|strand) x rect
    nucleotides tube/slab shape box

  

> select clear

> open 7dsu

7dsu title:  
Structure of Mod subunit of the Type III restriction-modification enzyme
Mbo45V [more info...]  
  
Chain information for 7dsu #2  
---  
Chain | Description  
A B | Mbo45V  
  
Non-standard residues in 7dsu #2  
---  
EDO — 1,2-ethanediol (ethylene glycol)  
SFG — sinefungin (adenosyl-ornithine)  
  

> select #2/B:12-548

3163 atoms, 3215 bonds, 4 pseudobonds, 420 residues, 2 models selected  

> delete sel

> select :EDO

6 atoms, 5 bonds, 1 residue, 1 model selected  

> delete sel

> select :SFG

54 atoms, 58 bonds, 2 residues, 1 model selected  

> delete sel

> hide atoms

> matchmaker #2 to #1 showAlignment true

Parameters  
---  
Chain pairing | bb  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker 4zcf, chain A (#1) with 7dsu, chain A (#2), sequence alignment
score = 527.4  
Alignment identifier is 1  
Showing consensus header ("seq_consensus" residue attribute) for alignment 1  
Showing conservation header ("seq_conservation" residue attribute) for
alignment 1  
Chains used in RMSD evaluation for alignment 1: 4zcf #1/A, 7dsu #2/A  
Showing rmsd header ("seq_rmsd" residue attribute) for alignment 1  
Hiding consensus header for alignment 1  
Hiding conservation header for alignment 1  
RMSD between 167 pruned atom pairs is 0.915 angstroms; (across all 343 pairs:
13.606)  
  

> set bgColor white

> ui tool show "Render by Attribute"

> key blue-white-red :0 :2 :3 showTool true

> ui mousemode right "color key"

> key fontSize 12

> key numericLabelSpacing equal

> key size 0.24000,0.05000

> key size 0.25000,0.05000

> key size 0.25000,0.04000

> key size 0.25000,0.03000

> key size 0.25000,0.02000

> key size 0.25000,0.03000

> key size 0.25000,0.04000

> key size 0.25000,0.03000

> key pos 0.69000,0.08000

> key pos 0.68000,0.08000

> key pos 0.67000,0.08000

> key pos 0.66000,0.08000

> key pos 0.65000,0.08000

> key pos 0.64000,0.08000

> key pos 0.63000,0.08000

> key pos 0.62000,0.08000

> key pos 0.61000,0.08000

> key bold true

> ui mousemode right translate

> color byattribute r:seq_rmsd #!2 target absc palette 0,blue:2,white:3,red
> noValueColor springgreen

3073 atoms, 415 residues, atom seq_rmsd range 0.156 to 51.2  

> color byattribute r:seq_rmsd #!2 target absc palette 0,blue:2,white:3,red
> noValueColor springgreen

3073 atoms, 415 residues, atom seq_rmsd range 0.156 to 51.2  

> color #1 tan

> set bgColor black

> ui tool show "Color Key"

> ui mousemode right "color key"

> ui mousemode right translate

> ui mousemode right label

> label delete residues

> set bgColor white

> label delete residues

[Repeated 1 time(s)]

> ui mousemode right label

> label delete residues

> ui mousemode right label

> 2dlabels text "RMSD (Å)"

> label delete residues

> ui mousemode right label

> label delete residues

> ui mousemode right label

> ui mousemode right "move label"

> 2dlabels #4.1 xpos 0.672 ypos 0.134

[Repeated 3 time(s)]

> 2dlabels #4.1 xpos 0.653 ypos 0.121

> 2dlabels #4.1 xpos 0.681 ypos 0.121

> 2dlabels #4.1 xpos 0.671 ypos 0.129

[Repeated 1 time(s)]

> 2dlabels text 12

> 2dlabels #4.2 xpos 0.500 ypos 0.500

> 2dlabels delete

> 2dlabels"RMSD (Å)' 12 bold

incomplete quoted text  

> 2dlabels"RMSD (Å)' 12

incomplete quoted text  

> 2dlabels 'RMSD (Å)' 12 bold

Expected 'all' or a 2d label name or a label models specifier or a keyword  

> 2dlabels 'RMSD (Å)' 12

Expected 'all' or a 2d label name or a label models specifier or a keyword  

> 2dlabels 'RMSD (Å)' 12

Expected 'all' or a 2d label name or a label models specifier or a keyword  

> 2dlabels text "RMSD (Å)" 12 bold

Expected a keyword  

> 2dlabels text "RMSD (Å)" 12

Expected a keyword  

> 2dlabels text "RMSD (Å)"

> 2dlabels #5.1 xpos 0.672 ypos 0.121

[Repeated 1 time(s)]

> 2dlabels #5.1 xpos 0.702 ypos 0.153

> delete 2dlabel text 'RMSD (Å)'

Missing or invalid "atoms" argument: invalid atoms specifier  

> delete 2dlabel

Missing or invalid "atoms" argument: invalid atoms specifier  

> 2dlabels delete

> color #1 tan

> set bgColor black

Drag select of 18 residues  

> select clear

Drag select of 1028 residues, 11 pseudobonds  

> select clear

Drag select of 1028 residues, 11 pseudobonds  

> select clear

> ui tool show "Color Key"

> ui mousemode right "color key"

> key size 0.24000,0.03000

> key size 0.23000,0.03000

> key size 0.22000,0.03000

> key size 0.21000,0.03000

> key size 0.20000,0.03000

> key size 0.19000,0.03000

> key size 0.18000,0.03000

> key size 0.17000,0.03000

> ui mousemode right "move label"

> select #1/A:226 #2/A:212

19 atoms, 19 bonds, 2 residues, 2 models selected  

> select #1/A:224 #2/A:210

15 atoms, 13 bonds, 2 residues, 2 models selected  

> select #1/A:312

5 atoms, 4 bonds, 1 residue, 1 model selected  

> select #1/A:256

6 atoms, 5 bonds, 1 residue, 1 model selected  

> select #1/A:256-261 #2/A:255-260

102 atoms, 104 bonds, 12 residues, 2 models selected  
MatchMaker Alignment [ID: 1] region 4zcf, chain A..7dsu, chain A [288-293]
RMSD: 18.478  
  

> select clear

[Repeated 1 time(s)]

> select #2/A:260

5 atoms, 4 bonds, 1 residue, 1 model selected  

> select #2/A:257-260

34 atoms, 34 bonds, 4 residues, 1 model selected  

> select #1/A:53

5 atoms, 4 bonds, 1 residue, 1 model selected  

> select #1/A:53-62 #2/A:51-60

148 atoms, 151 bonds, 20 residues, 2 models selected  
MatchMaker Alignment [ID: 1] region 4zcf, chain A..7dsu, chain A [62-71] RMSD:
5.844  
  

> view sel

> lighting soft

> lighting full

> lighting flat

> set bgColor white

> set bgColor #ffffff00

> select clear

> view

> lighting shadows true intensity 0.5

> lighting shadows false

> lighting flat

> graphics silhouettes false

> set bgColor black

> set bgColor transparent

> lighting flat

> graphics silhouettes false

> lighting flat

> set bgColor white

> set bgColor #ffffff00

> select #1/A:62

4 atoms, 3 bonds, 1 residue, 1 model selected  

> select #1/A:62 #2/A:60

15 atoms, 14 bonds, 2 residues, 2 models selected  
MatchMaker Alignment [ID: 1] region 4zcf, chain A..7dsu, chain A [71] RMSD:
3.811  
  

> select #1/A:62,259-262 #2/A:60,258-260

72 atoms, 70 bonds, 9 residues, 2 models selected  
MatchMaker Alignment [ID: 1] region 4zcf, chain A..7dsu, chain A [71] + 1
other block RMSD: 13.237  
  

> select clear

> select #1/A:62-300 #2/A:60-260

3275 atoms, 3342 bonds, 2 pseudobonds, 416 residues, 4 models selected  
MatchMaker Alignment [ID: 1] region 4zcf, chain A..7dsu, chain A [71] + 2
other blocks RMSD: 6.604  
  

> select clear

> select #1/A:294

5 atoms, 4 bonds, 1 residue, 1 model selected  

> select #1/A:62-300 #2/A:60-260

3275 atoms, 3342 bonds, 2 pseudobonds, 416 residues, 4 models selected  
MatchMaker Alignment [ID: 1] region 4zcf, chain A..7dsu, chain A [71] + 3
other blocks RMSD: 7.571  
  

> select #1/A:62-300 #2/A:60-260

3275 atoms, 3342 bonds, 2 pseudobonds, 416 residues, 4 models selected  
MatchMaker Alignment [ID: 1] region 4zcf, chain A..7dsu, chain A [71] + 4
other blocks RMSD: 7.571  
  

> select #1/A:62-300 #2/A:60-260

3275 atoms, 3342 bonds, 2 pseudobonds, 416 residues, 4 models selected  
MatchMaker Alignment [ID: 1] region 4zcf, chain A..7dsu, chain A [71] + 5
other blocks RMSD: 7.571  
  

> select clear

> select #1/A:62-300 #2/A:60-260

3275 atoms, 3342 bonds, 2 pseudobonds, 416 residues, 4 models selected  
MatchMaker Alignment [ID: 1] region 4zcf, chain A..7dsu, chain A [71] + 6
other blocks RMSD: 7.004  
  
Drag select of 1028 residues, 11 pseudobonds  

> cartoon hide (#!1-2 & sel)

> lighting simple

> set bgColor black

> set bgColor transparent

> set bgColor white

> set bgColor #ffffff00

> lighting flat

> save "D:/Mirror/My Ph.D. Data/Type III Phasevariable Mods PV SSRs/h cd-HIT
> est/80% ID DNA Cluster Analysis/ChimeraX/Catalytic Domain 7dsu_A and 4zcf_A
> align.cxs"

——— End of log from Mon Dec 25 13:02:21 2023 ———

opened ChimeraX session  

> show #!2 target m

> view #1 clip false

[Repeated 2 time(s)]

> select subtract #1.1

4628 atoms, 3342 bonds, 9 pseudobonds, 612 residues, 4 models selected  

> select subtract #1.2

4628 atoms, 3342 bonds, 9 pseudobonds, 612 residues, 4 models selected  

> close #1

> close #2

> close

> open 4zcf

4zcf title:  
Structural basis of asymmetric DNA methylation and ATP-triggered long-range
diffusion by EcoP15I [more info...]  
  
Chain information for 4zcf #1  
---  
Chain | Description | UniProt  
A B | Restriction endonuclease EcoP15I, modification subunit | Q5ZND1_ECOLX
1-644  
C | Restriction endonuclease EcoP15I, restriction subunit | Q5ZND2_ECOLX 1-970  
D | DNA 20-mer ATACAGCAGTAGACTATGAT |  
E | DNA 20-mer AATCATAGTCTACTGCTGTA |  
  
Non-standard residues in 4zcf #1  
---  
AMP — adenosine monophosphate  
CA — calcium ion  
MN — manganese (II) ion  
  
Associated 4zcf chain A to 4zcf, chain A with 0 mismatches  
Associated 4zcf chain B to 4zcf, chain A with 0 mismatches  
Drag select of 14929 atoms, 86 pseudobonds, 25 bonds  

> preset "initial styles" cartoon

Using preset: Initial Styles / Cartoon  
Preset implemented in Python; no expansion to individual ChimeraX commands
available.  

> select /D

421 atoms, 464 bonds, 2 pseudobonds, 28 residues, 2 models selected  

> delete sel

> select /E

410 atoms, 453 bonds, 25 residues, 1 model selected  

> delete sel

> select /C

4479 atoms, 4543 bonds, 19 pseudobonds, 632 residues, 2 models selected  

> delete sel

> select /B

4741 atoms, 4798 bonds, 9 pseudobonds, 648 residues, 2 models selected  

> delete sel

Drag select of 15 atoms, 616 residues, 10 pseudobonds, 12 bonds  

> hide (#!1 & sel) target a

> hide solvent

> open 7dsu

7dsu title:  
Structure of Mod subunit of the Type III restriction-modification enzyme
Mbo45V [more info...]  
  
Chain information for 7dsu #2  
---  
Chain | Description  
A B | Mbo45V  
  
Non-standard residues in 7dsu #2  
---  
EDO — 1,2-ethanediol (ethylene glycol)  
SFG — sinefungin (adenosyl-ornithine)  
  
Associated 7dsu chain A to 7dsu, chain A with 0 mismatches  
Associated 7dsu chain B to 7dsu, chain A with 0 mismatches  

> select #2/B

3199 atoms, 3249 bonds, 4 pseudobonds, 425 residues, 2 models selected  

> delsel

Unknown command: delsel  

> delete sel

Drag select of 1028 residues, 11 pseudobonds, 83 atoms, 77 bonds  

> hide (#!1-2 & sel) target ab

> matchmaker #2 to #1 showAlignment true

Parameters  
---  
Chain pairing | bb  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker 4zcf, chain A (#1) with 7dsu, chain A (#2), sequence alignment
score = 527.4  
Alignment identifier is 2  
Showing consensus header ("seq_consensus" residue attribute) for alignment 2  
Showing conservation header ("seq_conservation" residue attribute) for
alignment 2  
Chains used in RMSD evaluation for alignment 2: 4zcf #1/A, 7dsu #2/A  
Showing rmsd header ("seq_rmsd" residue attribute) for alignment 2  
Hiding consensus header for alignment 2  
Hiding conservation header for alignment 2  
RMSD between 167 pruned atom pairs is 0.915 angstroms; (across all 343 pairs:
13.606)  
  
Chains used in RMSD evaluation for alignment 1: 4zcf #1/A, 7dsu #2/A  

> lighting flat

> set bgColor white

> ui tool show "Render by Attribute"

Traceback (most recent call last):  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 768, in _set_value_cb  
self._redraw_cb()  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 652, in _redraw_cb  
filled_bins = self._bins(int(hist_width * filled_range / full_range))  
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\render_by_attr\tool.py", line 345, in <lambda>  
numpy.histogram(values, bins=num_bins, range=(min_val, max_val),
density=False)[0])  
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\numpy\lib\histograms.py", line 780, in histogram  
bin_edges, uniform_bins = _get_bin_edges(a, bins, range, weights)  
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\numpy\lib\histograms.py", line 424, in _get_bin_edges  
raise ValueError('`bins` must be positive, when an integer')  
ValueError: `bins` must be positive, when an integer  
  
ValueError: `bins` must be positive, when an integer  
  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\numpy\lib\histograms.py", line 424, in _get_bin_edges  
raise ValueError('`bins` must be positive, when an integer')  
  
See log for complete Python traceback.  
  
Traceback (most recent call last):  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 179, in <lambda>  
if event.modifiers() & mod_key_info("shift")[0] else
self._select_marker_cb(event)  
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 723, in _select_marker_cb  
self._set_sel_marker(marker, drag_start=event)  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 752, in _set_sel_marker  
self._last_mouse_xy = self._abs_xy((drag_start.scenePos().x(),
drag_start.scenePos().y()))  
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 441, in _abs_xy  
num_bins = len(self._bins)  
^^^^^^^^^^^^^^^  
TypeError: object of type 'function' has no len()  
  
TypeError: object of type 'function' has no len()  
  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 441, in _abs_xy  
num_bins = len(self._bins)  
^^^^^^^^^^^^^^^  
  
See log for complete Python traceback.  
  
Traceback (most recent call last):  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 180, in <lambda>  
self._hist_scene.mouseMoveEvent = lambda event: self._move_marker_cb(event) \  
^^^^^^^^^^^^^^^^^^^^^^^^^^^  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 576, in _move_marker_cb  
mouse_xy = self._abs_xy((event.scenePos().x(), event.scenePos().y()))  
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 441, in _abs_xy  
num_bins = len(self._bins)  
^^^^^^^^^^^^^^^  
TypeError: object of type 'function' has no len()  
  
TypeError: object of type 'function' has no len()  
  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 441, in _abs_xy  
num_bins = len(self._bins)  
^^^^^^^^^^^^^^^  
  
See log for complete Python traceback.  
  
Traceback (most recent call last):  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 179, in <lambda>  
if event.modifiers() & mod_key_info("shift")[0] else
self._select_marker_cb(event)  
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 723, in _select_marker_cb  
self._set_sel_marker(marker, drag_start=event)  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 752, in _set_sel_marker  
self._last_mouse_xy = self._abs_xy((drag_start.scenePos().x(),
drag_start.scenePos().y()))  
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 441, in _abs_xy  
num_bins = len(self._bins)  
^^^^^^^^^^^^^^^  
TypeError: object of type 'function' has no len()  
  
TypeError: object of type 'function' has no len()  
  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 441, in _abs_xy  
num_bins = len(self._bins)  
^^^^^^^^^^^^^^^  
  
See log for complete Python traceback.  
  
Traceback (most recent call last):  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 180, in <lambda>  
self._hist_scene.mouseMoveEvent = lambda event: self._move_marker_cb(event) \  
^^^^^^^^^^^^^^^^^^^^^^^^^^^  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 576, in _move_marker_cb  
mouse_xy = self._abs_xy((event.scenePos().x(), event.scenePos().y()))  
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 441, in _abs_xy  
num_bins = len(self._bins)  
^^^^^^^^^^^^^^^  
TypeError: object of type 'function' has no len()  
  
TypeError: object of type 'function' has no len()  
  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 441, in _abs_xy  
num_bins = len(self._bins)  
^^^^^^^^^^^^^^^  
  
See log for complete Python traceback.  
  
Traceback (most recent call last):  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 769, in _set_value_cb  
self._move_cur_marker(v)  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 570, in _move_cur_marker  
self._active_markers._update_plot()  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 1231, in _update_plot  
self._update_marker_coordinates()  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 1216, in
_update_marker_coordinates  
x, y = self._scene_xy(m.xy)  
^^^^^^^^^^^^^^^^^^^^  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 1099, in _scene_xy  
return self.histogram._scene_xy(abs_xy)  
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 512, in _scene_xy  
num_bins = len(self._bins)  
^^^^^^^^^^^^^^^  
TypeError: object of type 'function' has no len()  
  
TypeError: object of type 'function' has no len()  
  
File "C:\Program Files\ChimeraX\bin\Lib\site-
packages\chimerax\ui\widgets\histogram.py", line 512, in _scene_xy  
num_bins = len(self._bins)  
^^^^^^^^^^^^^^^  
  
See log for complete Python traceback.  
  




OpenGL version: 3.3.0 NVIDIA 529.08
OpenGL renderer: Quadro P620/PCIe/SSE2
OpenGL vendor: NVIDIA Corporation

Python: 3.11.2
Locale: en_IN.cp1252
Qt version: PyQt6 6.3.1, Qt 6.3.1
Qt runtime version: 6.3.2
Qt platform: windows

Manufacturer: LENOVO
Model: 20TQS04M00
OS: Microsoft Windows 11 Pro (Build 22621)
Memory: 16,919,126,016
MaxProcessMemory: 137,438,953,344
CPU: 12 Intel(R) Core(TM) i7-10750H CPU @ 2.60GHz
OSLanguage: en-US

Installed Packages:
    alabaster: 0.7.13
    appdirs: 1.4.4
    asttokens: 2.4.1
    Babel: 2.14.0
    backcall: 0.2.0
    beautifulsoup4: 4.11.2
    blockdiag: 3.0.0
    blosc2: 2.0.0
    build: 0.10.0
    certifi: 2023.11.17
    cftime: 1.6.3
    charset-normalizer: 3.3.2
    ChimeraX-AddCharge: 1.5.13
    ChimeraX-AddH: 2.2.5
    ChimeraX-AlignmentAlgorithms: 2.0.1
    ChimeraX-AlignmentHdrs: 3.4.1
    ChimeraX-AlignmentMatrices: 2.1
    ChimeraX-Alignments: 2.12.1
    ChimeraX-AlphaFold: 1.0
    ChimeraX-AltlocExplorer: 1.1.1
    ChimeraX-AmberInfo: 1.0
    ChimeraX-Arrays: 1.1
    ChimeraX-Atomic: 1.49.1
    ChimeraX-AtomicLibrary: 12.1.3
    ChimeraX-AtomSearch: 2.0.1
    ChimeraX-AxesPlanes: 2.3.2
    ChimeraX-BasicActions: 1.1.2
    ChimeraX-BILD: 1.0
    ChimeraX-BlastProtein: 2.1.2
    ChimeraX-BondRot: 2.0.4
    ChimeraX-BugReporter: 1.0.1
    ChimeraX-BuildStructure: 2.10.5
    ChimeraX-Bumps: 1.0
    ChimeraX-BundleBuilder: 1.2.2
    ChimeraX-ButtonPanel: 1.0.1
    ChimeraX-CageBuilder: 1.0.1
    ChimeraX-CellPack: 1.0
    ChimeraX-Centroids: 1.3.2
    ChimeraX-ChangeChains: 1.1
    ChimeraX-CheckWaters: 1.3.2
    ChimeraX-ChemGroup: 2.0.1
    ChimeraX-Clashes: 2.2.4
    ChimeraX-ColorActions: 1.0.3
    ChimeraX-ColorGlobe: 1.0
    ChimeraX-ColorKey: 1.5.5
    ChimeraX-CommandLine: 1.2.5
    ChimeraX-ConnectStructure: 2.0.1
    ChimeraX-Contacts: 1.0.1
    ChimeraX-Core: 1.7
    ChimeraX-CoreFormats: 1.2
    ChimeraX-coulombic: 1.4.2
    ChimeraX-Crosslinks: 1.0
    ChimeraX-Crystal: 1.0
    ChimeraX-CrystalContacts: 1.0.1
    ChimeraX-DataFormats: 1.2.3
    ChimeraX-Dicom: 1.2
    ChimeraX-DistMonitor: 1.4
    ChimeraX-DockPrep: 1.1.3
    ChimeraX-Dssp: 2.0
    ChimeraX-EMDB-SFF: 1.0
    ChimeraX-ESMFold: 1.0
    ChimeraX-FileHistory: 1.0.1
    ChimeraX-FunctionKey: 1.0.1
    ChimeraX-Geometry: 1.3
    ChimeraX-gltf: 1.0
    ChimeraX-Graphics: 1.1.1
    ChimeraX-Hbonds: 2.4
    ChimeraX-Help: 1.2.2
    ChimeraX-HKCage: 1.3
    ChimeraX-IHM: 1.1
    ChimeraX-ImageFormats: 1.2
    ChimeraX-IMOD: 1.0
    ChimeraX-IO: 1.0.1
    ChimeraX-ItemsInspection: 1.0.1
    ChimeraX-IUPAC: 1.0
    ChimeraX-Label: 1.1.8
    ChimeraX-ListInfo: 1.2.2
    ChimeraX-Log: 1.1.6
    ChimeraX-LookingGlass: 1.1
    ChimeraX-Maestro: 1.9.1
    ChimeraX-Map: 1.1.4
    ChimeraX-MapData: 2.0
    ChimeraX-MapEraser: 1.0.1
    ChimeraX-MapFilter: 2.0.1
    ChimeraX-MapFit: 2.0
    ChimeraX-MapSeries: 2.1.1
    ChimeraX-Markers: 1.0.1
    ChimeraX-Mask: 1.0.2
    ChimeraX-MatchMaker: 2.1.2
    ChimeraX-MCopy: 1.0
    ChimeraX-MDcrds: 2.6
    ChimeraX-MedicalToolbar: 1.0.2
    ChimeraX-Meeting: 1.0.1
    ChimeraX-MLP: 1.1.1
    ChimeraX-mmCIF: 2.12.1
    ChimeraX-MMTF: 2.2
    ChimeraX-Modeller: 1.5.13
    ChimeraX-ModelPanel: 1.4
    ChimeraX-ModelSeries: 1.0.1
    ChimeraX-Mol2: 2.0.3
    ChimeraX-Mole: 1.0
    ChimeraX-Morph: 1.0.2
    ChimeraX-MouseModes: 1.2
    ChimeraX-Movie: 1.0
    ChimeraX-Neuron: 1.0
    ChimeraX-Nifti: 1.1
    ChimeraX-NRRD: 1.1
    ChimeraX-Nucleotides: 2.0.3
    ChimeraX-OpenCommand: 1.13.1
    ChimeraX-PDB: 2.7.3
    ChimeraX-PDBBio: 1.0.1
    ChimeraX-PDBLibrary: 1.0.3
    ChimeraX-PDBMatrices: 1.0
    ChimeraX-PickBlobs: 1.0.1
    ChimeraX-Positions: 1.0
    ChimeraX-PresetMgr: 1.1
    ChimeraX-PubChem: 2.1
    ChimeraX-ReadPbonds: 1.0.1
    ChimeraX-Registration: 1.1.2
    ChimeraX-RemoteControl: 1.0
    ChimeraX-RenderByAttr: 1.1
    ChimeraX-RenumberResidues: 1.1
    ChimeraX-ResidueFit: 1.0.1
    ChimeraX-RestServer: 1.2
    ChimeraX-RNALayout: 1.0
    ChimeraX-RotamerLibMgr: 4.0
    ChimeraX-RotamerLibsDunbrack: 2.0
    ChimeraX-RotamerLibsDynameomics: 2.0
    ChimeraX-RotamerLibsRichardson: 2.0
    ChimeraX-SaveCommand: 1.5.1
    ChimeraX-SchemeMgr: 1.0
    ChimeraX-SDF: 2.0.2
    ChimeraX-Segger: 1.0
    ChimeraX-Segment: 1.0.1
    ChimeraX-SelInspector: 1.0
    ChimeraX-SeqView: 2.11
    ChimeraX-Shape: 1.0.1
    ChimeraX-Shell: 1.0.1
    ChimeraX-Shortcuts: 1.1.1
    ChimeraX-ShowSequences: 1.0.2
    ChimeraX-SideView: 1.0.1
    ChimeraX-Smiles: 2.1.2
    ChimeraX-SmoothLines: 1.0
    ChimeraX-SpaceNavigator: 1.0
    ChimeraX-StdCommands: 1.12.3
    ChimeraX-STL: 1.0.1
    ChimeraX-Storm: 1.0
    ChimeraX-StructMeasure: 1.1.2
    ChimeraX-Struts: 1.0.1
    ChimeraX-Surface: 1.0.1
    ChimeraX-SwapAA: 2.0.1
    ChimeraX-SwapRes: 2.2.2
    ChimeraX-TapeMeasure: 1.0
    ChimeraX-TaskManager: 1.0
    ChimeraX-Test: 1.0
    ChimeraX-Toolbar: 1.1.2
    ChimeraX-ToolshedUtils: 1.2.4
    ChimeraX-Topography: 1.0
    ChimeraX-ToQuest: 1.0
    ChimeraX-Tug: 1.0.1
    ChimeraX-UI: 1.33.2
    ChimeraX-uniprot: 2.3
    ChimeraX-UnitCell: 1.0.1
    ChimeraX-ViewDockX: 1.3.2
    ChimeraX-VIPERdb: 1.0
    ChimeraX-Vive: 1.1
    ChimeraX-VolumeMenu: 1.0.1
    ChimeraX-vrml: 1.0
    ChimeraX-VTK: 1.0
    ChimeraX-WavefrontOBJ: 1.0
    ChimeraX-WebCam: 1.0.2
    ChimeraX-WebServices: 1.1.3
    ChimeraX-Zone: 1.0.1
    colorama: 0.4.6
    comm: 0.2.0
    comtypes: 1.1.14
    contourpy: 1.2.0
    cxservices: 1.2.2
    cycler: 0.12.1
    Cython: 0.29.33
    debugpy: 1.8.0
    decorator: 5.1.1
    docutils: 0.19
    executing: 2.0.1
    filelock: 3.9.0
    fonttools: 4.47.0
    funcparserlib: 2.0.0a0
    glfw: 2.6.4
    grako: 3.16.5
    h5py: 3.10.0
    html2text: 2020.1.16
    idna: 3.6
    ihm: 0.38
    imagecodecs: 2023.9.18
    imagesize: 1.4.1
    ipykernel: 6.23.2
    ipython: 8.14.0
    ipython-genutils: 0.2.0
    ipywidgets: 8.1.1
    jedi: 0.18.2
    Jinja2: 3.1.2
    jupyter-client: 8.2.0
    jupyter-core: 5.5.1
    jupyterlab-widgets: 3.0.9
    kiwisolver: 1.4.5
    line-profiler: 4.0.2
    lxml: 4.9.2
    lz4: 4.3.2
    MarkupSafe: 2.1.3
    matplotlib: 3.7.2
    matplotlib-inline: 0.1.6
    msgpack: 1.0.4
    nest-asyncio: 1.5.8
    netCDF4: 1.6.2
    networkx: 3.1
    nibabel: 5.0.1
    nptyping: 2.5.0
    numexpr: 2.8.8
    numpy: 1.25.1
    openvr: 1.23.701
    packaging: 23.2
    ParmEd: 3.4.3
    parso: 0.8.3
    pep517: 0.13.0
    pickleshare: 0.7.5
    Pillow: 10.0.1
    pip: 23.0
    pkginfo: 1.9.6
    platformdirs: 4.1.0
    prompt-toolkit: 3.0.43
    psutil: 5.9.5
    pure-eval: 0.2.2
    py-cpuinfo: 9.0.0
    pycollada: 0.7.2
    pydicom: 2.3.0
    Pygments: 2.16.1
    pynrrd: 1.0.0
    PyOpenGL: 3.1.7
    PyOpenGL-accelerate: 3.1.7
    pyopenxr: 1.0.2801
    pyparsing: 3.0.9
    pyproject-hooks: 1.0.0
    PyQt6-commercial: 6.3.1
    PyQt6-Qt6: 6.3.2
    PyQt6-sip: 13.4.0
    PyQt6-WebEngine-commercial: 6.3.1
    PyQt6-WebEngine-Qt6: 6.3.2
    python-dateutil: 2.8.2
    pytz: 2023.3.post1
    pywin32: 305
    pyzmq: 25.1.2
    qtconsole: 5.4.3
    QtPy: 2.4.1
    RandomWords: 0.4.0
    requests: 2.31.0
    scipy: 1.11.1
    setuptools: 67.4.0
    sfftk-rw: 0.7.3
    six: 1.16.0
    snowballstemmer: 2.2.0
    sortedcontainers: 2.4.0
    soupsieve: 2.5
    sphinx: 6.1.3
    sphinx-autodoc-typehints: 1.22
    sphinxcontrib-applehelp: 1.0.7
    sphinxcontrib-blockdiag: 3.0.0
    sphinxcontrib-devhelp: 1.0.5
    sphinxcontrib-htmlhelp: 2.0.4
    sphinxcontrib-jsmath: 1.0.1
    sphinxcontrib-qthelp: 1.0.6
    sphinxcontrib-serializinghtml: 1.1.9
    stack-data: 0.6.3
    superqt: 0.5.0
    tables: 3.8.0
    tcia-utils: 1.5.1
    tifffile: 2023.7.18
    tinyarray: 1.2.4
    tomli: 2.0.1
    tornado: 6.4
    traitlets: 5.9.0
    typing-extensions: 4.9.0
    tzdata: 2023.3
    urllib3: 2.1.0
    wcwidth: 0.2.12
    webcolors: 1.12
    wheel: 0.38.4
    wheel-filename: 1.4.1
    widgetsnbextension: 4.0.9
    WMI: 1.5.1

Change History (2)

comment:1 by Eric Pettersen, 3 years ago

Component: UnassignedGeneral Controls
Owner: set to Eric Pettersen
Platform: all
Project: ChimeraX
Status: newaccepted
Summary: ChimeraX bug report submissionHistogram:`bins` must be positive

comment:2 by Eric Pettersen, 3 years ago

Resolution: fixed
Status: acceptedclosed
Note: See TracTickets for help on using tickets.