#18692 closed defect (fixed)
Sequence viewer 'PySide6.QtWebEngineCore.QWebEngineUrlRequestInfo' object has no attribute 'sceneBoundingRect'
| Reported by: | Owned by: | Zach Pearson | |
|---|---|---|---|
| Priority: | normal | Milestone: | |
| Component: | Window Toolkit | Version: | |
| Keywords: | Cc: | Eric Pettersen | |
| Blocked By: | Blocking: | ||
| Notify when closed: | Platform: | all | |
| Project: | ChimeraX |
Description
The following bug report has been submitted:
Platform: macOS-15.6.1-arm64-arm-64bit
ChimeraX Version: 1.11.dev202508252314 (2025-08-25 23:14:16 UTC)
Description
Tried to show sequence viewer on chain H of PDB 9GUJ and got this error with PySide6.
Log:
UCSF ChimeraX version: 1.11.dev202508252314 (2025-08-25)
© 2016-2025 Regents of the University of California. All rights reserved.
How to cite UCSF ChimeraX
> ui tool show Boltz
> boltz predict protein
> MLANENSLLTMFRELGSGKLPLQIEQFERGKTIFFPGDPAERVYLLVKGAVKLSRVYESGEEITVALLRENSVFGVLSLLTGQRSDRFYHAVAFTPVQLFSVPIEFMQKALIERPELANVMLQGLSSRILQTEMMIETLAHRDMGSRLVSFLLILCRDFGIPSPDGITIDLKLSHQAIAEAIGSTRVTVTRLLGDLRESKLIAIHKKRITVFNPVALSQQFS
> protein
> MLANENSLLTMFRELGSGKLPLQIEQFERGKTIFFPGDPAERVYLLVKGAVKLSRVYESGEEITVALLRENSVFGVLSLLTGQRSDRFYHAVAFTPVQLFSVPIEFMQKALIERPELANVMLQGLSSRILQTEMMIETLAHRDMGSRLVSFLLILCRDFGIPSPDGITIDLKLSHQAIAEAIGSTRVTVTRLLGDLRESKLIAIHKKRITVFNPVALSQQFS
> dna CATTTTTATGTATCAGCTGATACATAAAAAT dna CATTTTTATGTATCAGCTGATACATAAAAAT
> ligandCcd AKG(2)
Running Boltz prediction of protein with 444 residues, nucleic acid sequence
with 62 residues, 2 ligands AKG (2) on gpu
Using cached multiple sequence alignment
/Users/goddard/Downloads/ChimeraX/BoltzMSA/9guk_C
> open 9guj
Summary of feedback from opening 9guj fetched from pdb
---
note | Fetching compressed mmCIF 9guj from http://files.rcsb.org/download/9guj.cif
9guj title:
Crystal structure of transcription factor NtcA from Synechococcus elongatus in
complex with its transcriptional co- activator PipX and its target DNA
(Crystal II) [more info...]
Chain information for 9guj #1
---
Chain | Description | UniProt
A B D F | Global nitrogen regulator | NTCA_SYNE7 1-222
C E G I | DNA |
H J K | PipX | Q7X386_SYNE7 1-89
Non-standard residues in 9guj #1
---
AKG — 2-oxoglutaric acid
11228 atoms have anisotropic B-factors. Depict anisotropic information with
Thermal Ellipsoids [start tool...] or the aniso command.
Confidence score 0.93, pTM 0.96, ipTM 0.95 (ligand 0.98, protein 0.96), pLDDT
0.93
Boltz prediction completed in 145 seconds (start boltz 4 sec, sequence search
0 sec, load weights 11 sec, structure inference 130 sec)
Please cite Boltz-1 Democratizing Biomolecular Interaction Modeling. BioRxiv
https://doi.org/10.1101/2024.11.19.624167 if you use these predictions.
> open
> /Users/goddard/Desktop/boltz/boltz_57/boltz_results_boltz_57/predictions/boltz_57/boltz_57_model_0.cif
> logInfo false
> close #1
> open 9gui
9gui title:
Crystal structure of transcription factor NtcA from Synechococcus elongatus in
complex with its target DNA. [more info...]
Chain information for 9gui #1
---
Chain | Description | UniProt
A B | Global nitrogen regulator | NTCA_SYNE7 1-222
C E | DNA (5'-D(P*AP*TP*TP*TP*TP*TP*AP*TP*GP*TP*AP*TP*C)-3') |
D F | DNA (5'-D(P*AP*GP*CP*TP*GP*AP*TP*AP*CP*AP*TP*AP*AP*AP*AP*AP*T)-3') |
Non-standard residues in 9gui #1
---
AKG — 2-oxoglutaric acid
10 atoms have alternate locations. Control/examine alternate locations with
Altloc Explorer [start tool...] or the altlocs command.
4529 atoms have anisotropic B-factors. Depict anisotropic information with
Thermal Ellipsoids [start tool...] or the aniso command.
> show cartoons
> hide atoms
> hide #2 models
> show ligand
> show #2 models
> mmaker #2 to #1
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker 9gui, chain B (#1) with boltz_57_model_0.cif, chain A (#2),
sequence alignment score = 1059.7
RMSD between 194 pruned atom pairs is 0.662 angstroms; (across all 212 pairs:
1.586)
> hide #!1 models
> show #!1 models
> hide #!1 models
> select :C
Nothing selected
> select :DC
266 atoms, 280 bonds, 14 residues, 2 models selected
> show sel & #2 atoms
> open 9guj
9guj title:
Crystal structure of transcription factor NtcA from Synechococcus elongatus in
complex with its transcriptional co- activator PipX and its target DNA
(Crystal II) [more info...]
Chain information for 9guj #3
---
Chain | Description | UniProt
A B D F | Global nitrogen regulator | NTCA_SYNE7 1-222
C E G I | DNA |
H J K | PipX | Q7X386_SYNE7 1-89
Non-standard residues in 9guj #3
---
AKG — 2-oxoglutaric acid
11228 atoms have anisotropic B-factors. Depict anisotropic information with
Thermal Ellipsoids [start tool...] or the aniso command.
Traceback (most recent call last):
File
"/Users/goddard/ucsf/chimerax/ChimeraX.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/ui/widgets/htmlview.py", line 316, in interceptRequest
self._callback(info)
File
"/Users/goddard/ucsf/chimerax/ChimeraX.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/ui/widgets/htmlview.py", line 93, in _intercept
return interceptor(request_info, *args)
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
File
"/Users/goddard/ucsf/chimerax/ChimeraX.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/log/tool.py", line 218, in link_intercept
cmd = qurl.toString(no_formatting)[6:].lstrip() # skip cxcmd:
^^^^^^^^^^^^^^^^^^^^^^^^^^^^
TypeError: 'PySide6.QtCore.QUrl.toString' called with wrong argument types:
PySide6.QtCore.QUrl.toString(UrlFormattingOption)
Supported signatures:
PySide6.QtCore.QUrl.toString(options:
PySide6.QtCore.QUrl.ComponentFormattingOption =
<ComponentFormattingOption.PrettyDecoded: 0>)
TypeError: 'PySide6.QtCore.QUrl.toString' called with wrong argument types:
PySide6.QtCore.QUrl.toString(UrlFormattingOption)
Supported signatures:
PySide6.QtCore.QUrl.toString(options:
PySide6.QtCore.QUrl.ComponentFormattingOption = )
File
"/Users/goddard/ucsf/chimerax/ChimeraX.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/log/tool.py", line 218, in link_intercept
cmd = qurl.toString(no_formatting)[6:].lstrip() # skip cxcmd:
^^^^^^^^^^^^^^^^^^^^^^^^^^^^
See log for complete Python traceback.
> ui tool show "Show Sequence Viewer"
> sequence chain #3/H
Alignment identifier is 3/H
Traceback (most recent call last):
File
"/Users/goddard/ucsf/chimerax/ChimeraX.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/seq_view/seq_canvas.py", line 253, in _actually_resize
self._reformat()
File
"/Users/goddard/ucsf/chimerax/ChimeraX.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/seq_view/seq_canvas.py", line 1028, in _reformat
self.lead_block = SeqBlock(label_scene, self.main_scene,
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
File
"/Users/goddard/ucsf/chimerax/ChimeraX.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/seq_view/seq_canvas.py", line 1657, in __init__
self.next_block = SeqBlock(label_scene, main_scene, self, self.font,
self.emphasis_font,
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
File
"/Users/goddard/ucsf/chimerax/ChimeraX.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/seq_view/seq_canvas.py", line 1652, in __init__
self.layout_lines(alignment.seqs, self.normal_label_color)
File
"/Users/goddard/ucsf/chimerax/ChimeraX.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/seq_view/seq_canvas.py", line 2349, in layout_lines
self._layout_line(line, label_color, bli, end)
File
"/Users/goddard/ucsf/chimerax/ChimeraX.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/seq_view/seq_canvas.py", line 2326, in _layout_line
item = self.make_item(line, self.seq_offset + i, xs[i],
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
File
"/Users/goddard/ucsf/chimerax/ChimeraX.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/seq_view/seq_canvas.py", line 2422, in make_item
rect = text.sceneBoundingRect()
^^^^^^^^^^^^^^^^^^^^^^
AttributeError: 'PySide6.QtWebEngineCore.QWebEngineUrlRequestInfo' object has
no attribute 'sceneBoundingRect'
AttributeError: 'PySide6.QtWebEngineCore.QWebEngineUrlRequestInfo' object has
no attribute 'sceneBoundingRect'
File
"/Users/goddard/ucsf/chimerax/ChimeraX.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/seq_view/seq_canvas.py", line 2422, in make_item
rect = text.sceneBoundingRect()
^^^^^^^^^^^^^^^^^^^^^^
See log for complete Python traceback.
OpenGL version: 4.1 Metal - 89.4
OpenGL renderer: Apple M2 Ultra
OpenGL vendor: Apple
Python: 3.11.9
Locale: en_US.UTF-8
Qt version: PySide6 6.9.2, Qt 6.9.2
Qt runtime version: 6.9.2
Qt platform: cocoa
Hardware:
Hardware Overview:
Model Name: Mac Studio
Model Identifier: Mac14,14
Model Number: Z1800003VLL/A
Chip: Apple M2 Ultra
Total Number of Cores: 24 (16 performance and 8 efficiency)
Memory: 64 GB
System Firmware Version: 11881.140.96
OS Loader Version: 11881.140.96
Software:
System Software Overview:
System Version: macOS 15.6.1 (24G90)
Kernel Version: Darwin 24.6.0
Time since boot: 12 days, 19 hours, 58 minutes
Graphics/Displays:
Apple M2 Ultra:
Chipset Model: Apple M2 Ultra
Type: GPU
Bus: Built-In
Total Number of Cores: 60
Vendor: Apple (0x106b)
Metal Support: Metal 3
Displays:
PHL 278B1:
Resolution: 3840 x 2160 (2160p/4K UHD 1 - Ultra High Definition)
UI Looks like: 1920 x 1080 @ 60.00Hz
Main Display: Yes
Mirror: Off
Online: Yes
Rotation: Supported
Installed Packages:
alabaster: 1.0.0
appdirs: 1.4.4
appnope: 0.1.4
asttokens: 3.0.0
babel: 2.17.0
beautifulsoup4: 4.13.4
blockdiag: 3.0.0
blosc2: 3.7.2
build: 1.3.0
certifi: 2025.8.3
cftime: 1.6.4.post1
charset-normalizer: 3.4.3
ChimeraX-AddCharge: 1.5.19
ChimeraX-AddH: 2.2.7
ChimeraX-AlignmentAlgorithms: 2.0.2
ChimeraX-AlignmentHdrs: 3.6.1
ChimeraX-AlignmentMatrices: 2.1
ChimeraX-Alignments: 3.0.1
ChimeraX-AlphaFold: 1.0.1
ChimeraX-AltlocExplorer: 1.1.2
ChimeraX-AmberInfo: 1.0
ChimeraX-Aniso: 1.3.2
ChimeraX-Arrays: 1.1
ChimeraX-Atomic: 1.60.14
ChimeraX-AtomicLibrary: 14.1.22
ChimeraX-AtomSearch: 2.0.1
ChimeraX-AxesPlanes: 2.4
ChimeraX-BasicActions: 1.1.3
ChimeraX-BILD: 1.0
ChimeraX-BlastProtein: 3.0.0
ChimeraX-Boltz: 1.1
ChimeraX-BondRot: 2.0.4
ChimeraX-BugReporter: 1.0.2
ChimeraX-BuildStructure: 2.13.1
ChimeraX-Bumps: 1.0
ChimeraX-BundleBuilder: 1.6.0
ChimeraX-ButtonPanel: 1.0.1
ChimeraX-CageBuilder: 1.0.1
ChimeraX-CellPack: 1.0
ChimeraX-Centroids: 1.4
ChimeraX-ChangeChains: 1.1
ChimeraX-CheckWaters: 1.5
ChimeraX-ChemGroup: 2.0.2
ChimeraX-Clashes: 2.3
ChimeraX-ColorActions: 1.0.5
ChimeraX-ColorGlobe: 1.0
ChimeraX-ColorKey: 1.5.8
ChimeraX-CommandLine: 1.3.0
ChimeraX-ConnectStructure: 2.0.1
ChimeraX-Contacts: 1.0.1
ChimeraX-Core: 1.11.dev202508252314
ChimeraX-CoreFormats: 1.2
ChimeraX-coulombic: 1.4.5
ChimeraX-Crosslinks: 1.0
ChimeraX-Crystal: 1.0
ChimeraX-CrystalContacts: 1.0.1
ChimeraX-DataFormats: 1.2.4
ChimeraX-Dicom: 1.2.7
ChimeraX-DistMonitor: 1.4.2
ChimeraX-DockPrep: 1.1.4
ChimeraX-Dssp: 2.0
ChimeraX-EMDB-SFF: 1.0
ChimeraX-ESMFold: 1.0
ChimeraX-FileHistory: 1.0.1
ChimeraX-FunctionKey: 1.0.1
ChimeraX-Geometry: 1.3
ChimeraX-gltf: 1.0
ChimeraX-Graphics: 1.4.1
ChimeraX-Hbonds: 2.5.3
ChimeraX-Help: 1.3
ChimeraX-HKCage: 1.3
ChimeraX-IHM: 1.1
ChimeraX-ImageFormats: 1.2
ChimeraX-IMOD: 1.0
ChimeraX-IO: 1.0.4
ChimeraX-ItemsInspection: 1.0.1
ChimeraX-IUPAC: 1.0
ChimeraX-KVFinder: 1.7.1
ChimeraX-Label: 1.1.14
ChimeraX-ListInfo: 1.2.2
ChimeraX-Log: 1.2
ChimeraX-LookingGlass: 1.1
ChimeraX-Maestro: 1.9.2
ChimeraX-Map: 1.3
ChimeraX-MapData: 2.0
ChimeraX-MapEraser: 1.0.1
ChimeraX-MapFilter: 2.0.1
ChimeraX-MapFit: 2.0
ChimeraX-MapSeries: 2.1.1
ChimeraX-Markers: 1.0.1
ChimeraX-Mask: 1.0.2
ChimeraX-MatchMaker: 2.2.2
ChimeraX-MCopy: 1.0
ChimeraX-MDcrds: 2.17.1
ChimeraX-MedicalToolbar: 1.1
ChimeraX-Meeting: 1.0.1
ChimeraX-Minimize: 1.2
ChimeraX-MLP: 1.1.1
ChimeraX-mmCIF: 2.16
ChimeraX-MMTF: 2.2
ChimeraX-ModelArchive: 1.0
ChimeraX-Modeller: 1.5.22
ChimeraX-ModelPanel: 1.5.1
ChimeraX-ModelSeries: 1.0.1
ChimeraX-Mol2: 2.0.3
ChimeraX-Mole: 1.0
ChimeraX-Morph: 1.0.2
ChimeraX-MouseModes: 1.2
ChimeraX-Movie: 1.0.1
ChimeraX-MutationScores: 1.0
ChimeraX-Neuron: 1.0
ChimeraX-Nifti: 1.2
ChimeraX-NMRSTAR: 1.0.2
ChimeraX-NRRD: 1.2
ChimeraX-Nucleotides: 2.0.3
ChimeraX-OpenCommand: 1.15.1
ChimeraX-OrthoPick: 1.0.1
ChimeraX-PDB: 2.7.10
ChimeraX-PDBBio: 1.0.1
ChimeraX-PDBLibrary: 1.0.4
ChimeraX-PDBMatrices: 1.0
ChimeraX-PhenixUI: 1.3.8
ChimeraX-PickBlobs: 1.0.1
ChimeraX-Positions: 1.0
ChimeraX-PresetMgr: 1.1.3
ChimeraX-ProfileGrids: 1.3.1
ChimeraX-PubChem: 2.2
ChimeraX-ReadPbonds: 1.0.1
ChimeraX-Registration: 1.1.2
ChimeraX-RemoteControl: 1.0
ChimeraX-RenderByAttr: 1.6.5
ChimeraX-RenumberResidues: 1.1
ChimeraX-ResidueFit: 1.0.1
ChimeraX-RestServer: 1.3.1
ChimeraX-RNALayout: 1.0
ChimeraX-RotamerLibMgr: 4.0
ChimeraX-RotamerLibsDunbrack: 2.0
ChimeraX-RotamerLibsDynameomics: 2.0
ChimeraX-RotamerLibsRichardson: 2.0
ChimeraX-SaveCommand: 1.5.2
ChimeraX-Scenes: 0.2.1
ChimeraX-SchemeMgr: 1.0
ChimeraX-SDF: 2.0.3
ChimeraX-Segger: 1.0
ChimeraX-Segment: 1.0.1
ChimeraX-Segmentations: 3.5.7
ChimeraX-SelInspector: 1.0
ChimeraX-SeqView: 2.17.2
ChimeraX-Shape: 1.1
ChimeraX-Shell: 1.0.1
ChimeraX-Shortcuts: 1.2.1
ChimeraX-ShowSequences: 1.0.3
ChimeraX-SideView: 1.0.1
ChimeraX-SimilarStructures: 1.0.1
ChimeraX-Smiles: 2.1.2
ChimeraX-SmoothLines: 1.0
ChimeraX-SpaceNavigator: 1.0
ChimeraX-StdCommands: 1.19.1
ChimeraX-STL: 1.0.1
ChimeraX-Storm: 1.0
ChimeraX-StructMeasure: 1.2.1
ChimeraX-Struts: 1.0.1
ChimeraX-Surface: 1.0.1
ChimeraX-SwapAA: 2.0.1
ChimeraX-SwapRes: 2.5.2
ChimeraX-TapeMeasure: 1.0
ChimeraX-TaskManager: 1.0
ChimeraX-Test: 1.0
ChimeraX-Toolbar: 1.2.3
ChimeraX-ToolshedUtils: 1.2.4
ChimeraX-Topography: 1.0
ChimeraX-ToQuest: 1.0
ChimeraX-Tug: 1.0.1
ChimeraX-UI: 1.48.2
ChimeraX-Umap: 1.0
ChimeraX-uniprot: 2.3.1
ChimeraX-UnitCell: 1.0.1
ChimeraX-ViewDock: 1.3.2
ChimeraX-VIPERdb: 1.0
ChimeraX-Vive: 1.1
ChimeraX-VolumeMenu: 1.0.1
ChimeraX-vrml: 1.0
ChimeraX-VTK: 1.0
ChimeraX-WavefrontOBJ: 1.0
ChimeraX-WebCam: 1.0.2
ChimeraX-WebServices: 1.1.5
ChimeraX-Zone: 1.0.1
colorama: 0.4.6
comm: 0.2.3
contourpy: 1.3.3
coverage: 7.10.5
cxservices: 1.2.3
cycler: 0.12.1
Cython: 3.1.3
debugpy: 1.8.16
decorator: 5.2.1
docutils: 0.21.2
executing: 2.2.0
filelock: 3.18.0
fonttools: 4.59.1
funcparserlib: 2.0.0a0
glfw: 2.9.0
grako: 3.16.5
h5py: 3.14.0
html2text: 2025.4.15
idna: 3.10
ihm: 2.2
imagecodecs: 2024.6.1
imagesize: 1.4.1
iniconfig: 2.1.0
ipykernel: 6.30.1
ipython: 9.4.0
ipython_pygments_lexers: 1.1.1
ipywidgets: 8.1.7
jedi: 0.19.2
Jinja2: 3.1.6
joblib: 1.5.0
jupyter_client: 8.6.3
jupyter_core: 5.8.1
jupyterlab_widgets: 3.0.15
kiwisolver: 1.4.9
line_profiler: 5.0.0
llvmlite: 0.44.0
lxml: 6.0.0
lz4: 4.3.2
Markdown: 3.8.2
MarkupSafe: 3.0.2
matplotlib: 3.10.3
matplotlib: 3.10.1
matplotlib-inline: 0.1.7
msgpack: 1.1.1
ndindex: 1.10.0
nest-asyncio: 1.6.0
netCDF4: 1.6.5
networkx: 3.3
nibabel: 5.2.0
nptyping: 2.5.0
numba: 0.61.2
numexpr: 2.11.0
numpy: 1.26.4
OpenMM: 8.2.0
openvr: 1.26.701
packaging: 25.0
ParmEd: 4.2.2
parso: 0.8.5
pep517: 0.13.1
pexpect: 4.9.0
pickleshare: 0.7.5
pillow: 11.3.0
pip: 25.2
pkginfo: 1.12.1.2
platformdirs: 4.3.8
pluggy: 1.6.0
prompt_toolkit: 3.0.51
psutil: 7.0.0
ptyprocess: 0.7.0
pure_eval: 0.2.3
py-cpuinfo: 9.0.0
pybind11: 3.0.1
pycollada: 0.8
pydicom: 2.4.4
Pygments: 2.18.0
pynmrstar: 3.3.5
pynndescent: 0.5.13
pynrrd: 1.0.0
PyOpenGL: 3.1.10
PyOpenGL-accelerate: 3.1.10
pyopenxr: 1.1.4501
pyparsing: 3.2.3
pyproject_hooks: 1.2.0
PySide6: 6.9.2
PySide6_Addons: 6.9.2
PySide6_Essentials: 6.9.2
pytest: 8.4.1
pytest-cov: 6.2.1
python-dateutil: 2.9.0.post0
pytz: 2025.2
pyzmq: 27.0.2
qtconsole: 5.6.1
QtPy: 2.4.3
qtshim: 1.2
RandomWords: 0.4.0
requests: 2.32.4
roman-numerals-py: 3.1.0
scikit-learn: 1.6.1
scipy: 1.14.0
setuptools: 80.9.0
sfftk-rw: 0.8.1
shiboken6: 6.9.2
six: 1.17.0
snowballstemmer: 3.0.1
sortedcontainers: 2.4.0
soupsieve: 2.7
Sphinx: 8.2.3
sphinx-autodoc-typehints: 3.2.0
sphinxcontrib-applehelp: 2.0.0
sphinxcontrib-blockdiag: 3.0.0
sphinxcontrib-devhelp: 2.0.0
sphinxcontrib-htmlhelp: 2.1.0
sphinxcontrib-jsmath: 1.0.1
sphinxcontrib-qthelp: 2.0.0
sphinxcontrib-serializinghtml: 2.0.0
stack-data: 0.6.3
superqt: 0.7.6
tables: 3.10.2
tcia_utils: 1.5.1
threadpoolctl: 3.6.0
tifffile: 2025.3.13
tinyarray: 1.2.5
tornado: 6.5.2
tqdm: 4.67.1
traitlets: 5.14.3
typing_extensions: 4.15.0
tzdata: 2025.2
umap-learn: 0.5.7
urllib3: 2.5.0
wcwidth: 0.2.13
webcolors: 24.11.1
wheel: 0.45.1
wheel-filename: 1.4.2
widgetsnbextension: 4.0.14
Change History (5)
comment:1 by , 11 months ago
| Cc: | added |
|---|---|
| Component: | Unassigned → Window Toolkit |
| Owner: | set to |
| Platform: | → all |
| Project: | → ChimeraX |
| Status: | new → assigned |
| Summary: | ChimeraX bug report submission → Sequence viewer 'PySide6.QtWebEngineCore.QWebEngineUrlRequestInfo' object has no attribute 'sceneBoundingRect' |
comment:2 by , 11 months ago
comment:3 by , 11 months ago
Though I get the same error in this ticket if I try to show the chain sequence via the link in the log ("'PySide6.QtCore.QUrl.toString' called with wrong argument types"), it works for me if I use the Show Sequences tool, unlike what happened in this ticket.
comment:4 by , 11 months ago
| Resolution: | → fixed |
|---|---|
| Status: | assigned → closed |
I think this is fixed for the same reason #18646 is fixed. I played around with Show Sequence Viewer and the log links and didn't encounter any tracebacks.
Note:
See TracTickets
for help on using tickets.
That variable ('text') is the return value from (QGraphicsScene).addSimpleText(...), which is supposed to return a QGraphicsSimpleTextItem, not a QWebEngineUrlRequestInfo.