Opened 11 months ago

Closed 10 months ago

Last modified 10 months ago

#18692 closed defect (fixed)

Sequence viewer 'PySide6.QtWebEngineCore.QWebEngineUrlRequestInfo' object has no attribute 'sceneBoundingRect'

Reported by: goddard@… Owned by: Zach Pearson
Priority: normal Milestone:
Component: Window Toolkit Version:
Keywords: Cc: Eric Pettersen
Blocked By: Blocking:
Notify when closed: Platform: all
Project: ChimeraX

Description

The following bug report has been submitted:
Platform:        macOS-15.6.1-arm64-arm-64bit
ChimeraX Version: 1.11.dev202508252314 (2025-08-25 23:14:16 UTC)
Description
Tried to show sequence viewer on chain H of PDB 9GUJ and got this error with PySide6.

Log:
UCSF ChimeraX version: 1.11.dev202508252314 (2025-08-25)  
© 2016-2025 Regents of the University of California. All rights reserved.  
How to cite UCSF ChimeraX  

> ui tool show Boltz

> boltz predict protein
> MLANENSLLTMFRELGSGKLPLQIEQFERGKTIFFPGDPAERVYLLVKGAVKLSRVYESGEEITVALLRENSVFGVLSLLTGQRSDRFYHAVAFTPVQLFSVPIEFMQKALIERPELANVMLQGLSSRILQTEMMIETLAHRDMGSRLVSFLLILCRDFGIPSPDGITIDLKLSHQAIAEAIGSTRVTVTRLLGDLRESKLIAIHKKRITVFNPVALSQQFS
> protein
> MLANENSLLTMFRELGSGKLPLQIEQFERGKTIFFPGDPAERVYLLVKGAVKLSRVYESGEEITVALLRENSVFGVLSLLTGQRSDRFYHAVAFTPVQLFSVPIEFMQKALIERPELANVMLQGLSSRILQTEMMIETLAHRDMGSRLVSFLLILCRDFGIPSPDGITIDLKLSHQAIAEAIGSTRVTVTRLLGDLRESKLIAIHKKRITVFNPVALSQQFS
> dna CATTTTTATGTATCAGCTGATACATAAAAAT dna CATTTTTATGTATCAGCTGATACATAAAAAT
> ligandCcd AKG(2)

Running Boltz prediction of protein with 444 residues, nucleic acid sequence
with 62 residues, 2 ligands AKG (2) on gpu  
Using cached multiple sequence alignment
/Users/goddard/Downloads/ChimeraX/BoltzMSA/9guk_C  

> open 9guj

Summary of feedback from opening 9guj fetched from pdb  
---  
note | Fetching compressed mmCIF 9guj from http://files.rcsb.org/download/9guj.cif  
  
9guj title:  
Crystal structure of transcription factor NtcA from Synechococcus elongatus in
complex with its transcriptional co- activator PipX and its target DNA
(Crystal II) [more info...]  
  
Chain information for 9guj #1  
---  
Chain | Description | UniProt  
A B D F | Global nitrogen regulator | NTCA_SYNE7 1-222  
C E G I | DNA |   
H J K | PipX | Q7X386_SYNE7 1-89  
  
Non-standard residues in 9guj #1  
---  
AKG — 2-oxoglutaric acid  
  
11228 atoms have anisotropic B-factors. Depict anisotropic information with
Thermal Ellipsoids [start tool...] or the aniso command.  
Confidence score 0.93, pTM 0.96, ipTM 0.95 (ligand 0.98, protein 0.96), pLDDT
0.93  
Boltz prediction completed in 145 seconds (start boltz 4 sec, sequence search
0 sec, load weights 11 sec, structure inference 130 sec)  
Please cite Boltz-1 Democratizing Biomolecular Interaction Modeling. BioRxiv
https://doi.org/10.1101/2024.11.19.624167 if you use these predictions.  

> open
> /Users/goddard/Desktop/boltz/boltz_57/boltz_results_boltz_57/predictions/boltz_57/boltz_57_model_0.cif
> logInfo false

> close #1

> open 9gui

9gui title:  
Crystal structure of transcription factor NtcA from Synechococcus elongatus in
complex with its target DNA. [more info...]  
  
Chain information for 9gui #1  
---  
Chain | Description | UniProt  
A B | Global nitrogen regulator | NTCA_SYNE7 1-222  
C E | DNA (5'-D(P*AP*TP*TP*TP*TP*TP*AP*TP*GP*TP*AP*TP*C)-3') |   
D F | DNA (5'-D(P*AP*GP*CP*TP*GP*AP*TP*AP*CP*AP*TP*AP*AP*AP*AP*AP*T)-3') |   
  
Non-standard residues in 9gui #1  
---  
AKG — 2-oxoglutaric acid  
  
10 atoms have alternate locations. Control/examine alternate locations with
Altloc Explorer [start tool...] or the altlocs command.  
4529 atoms have anisotropic B-factors. Depict anisotropic information with
Thermal Ellipsoids [start tool...] or the aniso command.  

> show cartoons

> hide atoms

> hide #2 models

> show ligand

> show #2 models

> mmaker #2 to #1

Parameters  
---  
Chain pairing | bb  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker 9gui, chain B (#1) with boltz_57_model_0.cif, chain A (#2),
sequence alignment score = 1059.7  
RMSD between 194 pruned atom pairs is 0.662 angstroms; (across all 212 pairs:
1.586)  
  

> hide #!1 models

> show #!1 models

> hide #!1 models

> select :C

Nothing selected  

> select :DC

266 atoms, 280 bonds, 14 residues, 2 models selected  

> show sel & #2 atoms

> open 9guj

9guj title:  
Crystal structure of transcription factor NtcA from Synechococcus elongatus in
complex with its transcriptional co- activator PipX and its target DNA
(Crystal II) [more info...]  
  
Chain information for 9guj #3  
---  
Chain | Description | UniProt  
A B D F | Global nitrogen regulator | NTCA_SYNE7 1-222  
C E G I | DNA |   
H J K | PipX | Q7X386_SYNE7 1-89  
  
Non-standard residues in 9guj #3  
---  
AKG — 2-oxoglutaric acid  
  
11228 atoms have anisotropic B-factors. Depict anisotropic information with
Thermal Ellipsoids [start tool...] or the aniso command.  
Traceback (most recent call last):  
File
"/Users/goddard/ucsf/chimerax/ChimeraX.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/ui/widgets/htmlview.py", line 316, in interceptRequest  
self._callback(info)  
File
"/Users/goddard/ucsf/chimerax/ChimeraX.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/ui/widgets/htmlview.py", line 93, in _intercept  
return interceptor(request_info, *args)  
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^  
File
"/Users/goddard/ucsf/chimerax/ChimeraX.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/log/tool.py", line 218, in link_intercept  
cmd = qurl.toString(no_formatting)[6:].lstrip() # skip cxcmd:  
^^^^^^^^^^^^^^^^^^^^^^^^^^^^  
TypeError: 'PySide6.QtCore.QUrl.toString' called with wrong argument types:  
PySide6.QtCore.QUrl.toString(UrlFormattingOption)  
Supported signatures:  
PySide6.QtCore.QUrl.toString(options:
PySide6.QtCore.QUrl.ComponentFormattingOption =
<ComponentFormattingOption.PrettyDecoded: 0>)  
  
TypeError: 'PySide6.QtCore.QUrl.toString' called with wrong argument types:  
PySide6.QtCore.QUrl.toString(UrlFormattingOption)  
Supported signatures:  
PySide6.QtCore.QUrl.toString(options:
PySide6.QtCore.QUrl.ComponentFormattingOption = )  
  
File
"/Users/goddard/ucsf/chimerax/ChimeraX.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/log/tool.py", line 218, in link_intercept  
cmd = qurl.toString(no_formatting)[6:].lstrip() # skip cxcmd:  
^^^^^^^^^^^^^^^^^^^^^^^^^^^^  
  
See log for complete Python traceback.  
  

> ui tool show "Show Sequence Viewer"

> sequence chain #3/H

Alignment identifier is 3/H  
Traceback (most recent call last):  
File
"/Users/goddard/ucsf/chimerax/ChimeraX.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/seq_view/seq_canvas.py", line 253, in _actually_resize  
self._reformat()  
File
"/Users/goddard/ucsf/chimerax/ChimeraX.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/seq_view/seq_canvas.py", line 1028, in _reformat  
self.lead_block = SeqBlock(label_scene, self.main_scene,  
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^  
File
"/Users/goddard/ucsf/chimerax/ChimeraX.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/seq_view/seq_canvas.py", line 1657, in __init__  
self.next_block = SeqBlock(label_scene, main_scene, self, self.font,
self.emphasis_font,  
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^  
File
"/Users/goddard/ucsf/chimerax/ChimeraX.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/seq_view/seq_canvas.py", line 1652, in __init__  
self.layout_lines(alignment.seqs, self.normal_label_color)  
File
"/Users/goddard/ucsf/chimerax/ChimeraX.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/seq_view/seq_canvas.py", line 2349, in layout_lines  
self._layout_line(line, label_color, bli, end)  
File
"/Users/goddard/ucsf/chimerax/ChimeraX.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/seq_view/seq_canvas.py", line 2326, in _layout_line  
item = self.make_item(line, self.seq_offset + i, xs[i],  
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^  
File
"/Users/goddard/ucsf/chimerax/ChimeraX.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/seq_view/seq_canvas.py", line 2422, in make_item  
rect = text.sceneBoundingRect()  
^^^^^^^^^^^^^^^^^^^^^^  
AttributeError: 'PySide6.QtWebEngineCore.QWebEngineUrlRequestInfo' object has
no attribute 'sceneBoundingRect'  
  
AttributeError: 'PySide6.QtWebEngineCore.QWebEngineUrlRequestInfo' object has
no attribute 'sceneBoundingRect'  
  
File
"/Users/goddard/ucsf/chimerax/ChimeraX.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/seq_view/seq_canvas.py", line 2422, in make_item  
rect = text.sceneBoundingRect()  
^^^^^^^^^^^^^^^^^^^^^^  
  
See log for complete Python traceback.  
  




OpenGL version: 4.1 Metal - 89.4
OpenGL renderer: Apple M2 Ultra
OpenGL vendor: Apple

Python: 3.11.9
Locale: en_US.UTF-8
Qt version: PySide6 6.9.2, Qt 6.9.2
Qt runtime version: 6.9.2
Qt platform: cocoa
Hardware:

    Hardware Overview:

      Model Name: Mac Studio
      Model Identifier: Mac14,14
      Model Number: Z1800003VLL/A
      Chip: Apple M2 Ultra
      Total Number of Cores: 24 (16 performance and 8 efficiency)
      Memory: 64 GB
      System Firmware Version: 11881.140.96
      OS Loader Version: 11881.140.96

Software:

    System Software Overview:

      System Version: macOS 15.6.1 (24G90)
      Kernel Version: Darwin 24.6.0
      Time since boot: 12 days, 19 hours, 58 minutes

Graphics/Displays:

    Apple M2 Ultra:

      Chipset Model: Apple M2 Ultra
      Type: GPU
      Bus: Built-In
      Total Number of Cores: 60
      Vendor: Apple (0x106b)
      Metal Support: Metal 3
      Displays:
        PHL 278B1:
          Resolution: 3840 x 2160 (2160p/4K UHD 1 - Ultra High Definition)
          UI Looks like: 1920 x 1080 @ 60.00Hz
          Main Display: Yes
          Mirror: Off
          Online: Yes
          Rotation: Supported


Installed Packages:
    alabaster: 1.0.0
    appdirs: 1.4.4
    appnope: 0.1.4
    asttokens: 3.0.0
    babel: 2.17.0
    beautifulsoup4: 4.13.4
    blockdiag: 3.0.0
    blosc2: 3.7.2
    build: 1.3.0
    certifi: 2025.8.3
    cftime: 1.6.4.post1
    charset-normalizer: 3.4.3
    ChimeraX-AddCharge: 1.5.19
    ChimeraX-AddH: 2.2.7
    ChimeraX-AlignmentAlgorithms: 2.0.2
    ChimeraX-AlignmentHdrs: 3.6.1
    ChimeraX-AlignmentMatrices: 2.1
    ChimeraX-Alignments: 3.0.1
    ChimeraX-AlphaFold: 1.0.1
    ChimeraX-AltlocExplorer: 1.1.2
    ChimeraX-AmberInfo: 1.0
    ChimeraX-Aniso: 1.3.2
    ChimeraX-Arrays: 1.1
    ChimeraX-Atomic: 1.60.14
    ChimeraX-AtomicLibrary: 14.1.22
    ChimeraX-AtomSearch: 2.0.1
    ChimeraX-AxesPlanes: 2.4
    ChimeraX-BasicActions: 1.1.3
    ChimeraX-BILD: 1.0
    ChimeraX-BlastProtein: 3.0.0
    ChimeraX-Boltz: 1.1
    ChimeraX-BondRot: 2.0.4
    ChimeraX-BugReporter: 1.0.2
    ChimeraX-BuildStructure: 2.13.1
    ChimeraX-Bumps: 1.0
    ChimeraX-BundleBuilder: 1.6.0
    ChimeraX-ButtonPanel: 1.0.1
    ChimeraX-CageBuilder: 1.0.1
    ChimeraX-CellPack: 1.0
    ChimeraX-Centroids: 1.4
    ChimeraX-ChangeChains: 1.1
    ChimeraX-CheckWaters: 1.5
    ChimeraX-ChemGroup: 2.0.2
    ChimeraX-Clashes: 2.3
    ChimeraX-ColorActions: 1.0.5
    ChimeraX-ColorGlobe: 1.0
    ChimeraX-ColorKey: 1.5.8
    ChimeraX-CommandLine: 1.3.0
    ChimeraX-ConnectStructure: 2.0.1
    ChimeraX-Contacts: 1.0.1
    ChimeraX-Core: 1.11.dev202508252314
    ChimeraX-CoreFormats: 1.2
    ChimeraX-coulombic: 1.4.5
    ChimeraX-Crosslinks: 1.0
    ChimeraX-Crystal: 1.0
    ChimeraX-CrystalContacts: 1.0.1
    ChimeraX-DataFormats: 1.2.4
    ChimeraX-Dicom: 1.2.7
    ChimeraX-DistMonitor: 1.4.2
    ChimeraX-DockPrep: 1.1.4
    ChimeraX-Dssp: 2.0
    ChimeraX-EMDB-SFF: 1.0
    ChimeraX-ESMFold: 1.0
    ChimeraX-FileHistory: 1.0.1
    ChimeraX-FunctionKey: 1.0.1
    ChimeraX-Geometry: 1.3
    ChimeraX-gltf: 1.0
    ChimeraX-Graphics: 1.4.1
    ChimeraX-Hbonds: 2.5.3
    ChimeraX-Help: 1.3
    ChimeraX-HKCage: 1.3
    ChimeraX-IHM: 1.1
    ChimeraX-ImageFormats: 1.2
    ChimeraX-IMOD: 1.0
    ChimeraX-IO: 1.0.4
    ChimeraX-ItemsInspection: 1.0.1
    ChimeraX-IUPAC: 1.0
    ChimeraX-KVFinder: 1.7.1
    ChimeraX-Label: 1.1.14
    ChimeraX-ListInfo: 1.2.2
    ChimeraX-Log: 1.2
    ChimeraX-LookingGlass: 1.1
    ChimeraX-Maestro: 1.9.2
    ChimeraX-Map: 1.3
    ChimeraX-MapData: 2.0
    ChimeraX-MapEraser: 1.0.1
    ChimeraX-MapFilter: 2.0.1
    ChimeraX-MapFit: 2.0
    ChimeraX-MapSeries: 2.1.1
    ChimeraX-Markers: 1.0.1
    ChimeraX-Mask: 1.0.2
    ChimeraX-MatchMaker: 2.2.2
    ChimeraX-MCopy: 1.0
    ChimeraX-MDcrds: 2.17.1
    ChimeraX-MedicalToolbar: 1.1
    ChimeraX-Meeting: 1.0.1
    ChimeraX-Minimize: 1.2
    ChimeraX-MLP: 1.1.1
    ChimeraX-mmCIF: 2.16
    ChimeraX-MMTF: 2.2
    ChimeraX-ModelArchive: 1.0
    ChimeraX-Modeller: 1.5.22
    ChimeraX-ModelPanel: 1.5.1
    ChimeraX-ModelSeries: 1.0.1
    ChimeraX-Mol2: 2.0.3
    ChimeraX-Mole: 1.0
    ChimeraX-Morph: 1.0.2
    ChimeraX-MouseModes: 1.2
    ChimeraX-Movie: 1.0.1
    ChimeraX-MutationScores: 1.0
    ChimeraX-Neuron: 1.0
    ChimeraX-Nifti: 1.2
    ChimeraX-NMRSTAR: 1.0.2
    ChimeraX-NRRD: 1.2
    ChimeraX-Nucleotides: 2.0.3
    ChimeraX-OpenCommand: 1.15.1
    ChimeraX-OrthoPick: 1.0.1
    ChimeraX-PDB: 2.7.10
    ChimeraX-PDBBio: 1.0.1
    ChimeraX-PDBLibrary: 1.0.4
    ChimeraX-PDBMatrices: 1.0
    ChimeraX-PhenixUI: 1.3.8
    ChimeraX-PickBlobs: 1.0.1
    ChimeraX-Positions: 1.0
    ChimeraX-PresetMgr: 1.1.3
    ChimeraX-ProfileGrids: 1.3.1
    ChimeraX-PubChem: 2.2
    ChimeraX-ReadPbonds: 1.0.1
    ChimeraX-Registration: 1.1.2
    ChimeraX-RemoteControl: 1.0
    ChimeraX-RenderByAttr: 1.6.5
    ChimeraX-RenumberResidues: 1.1
    ChimeraX-ResidueFit: 1.0.1
    ChimeraX-RestServer: 1.3.1
    ChimeraX-RNALayout: 1.0
    ChimeraX-RotamerLibMgr: 4.0
    ChimeraX-RotamerLibsDunbrack: 2.0
    ChimeraX-RotamerLibsDynameomics: 2.0
    ChimeraX-RotamerLibsRichardson: 2.0
    ChimeraX-SaveCommand: 1.5.2
    ChimeraX-Scenes: 0.2.1
    ChimeraX-SchemeMgr: 1.0
    ChimeraX-SDF: 2.0.3
    ChimeraX-Segger: 1.0
    ChimeraX-Segment: 1.0.1
    ChimeraX-Segmentations: 3.5.7
    ChimeraX-SelInspector: 1.0
    ChimeraX-SeqView: 2.17.2
    ChimeraX-Shape: 1.1
    ChimeraX-Shell: 1.0.1
    ChimeraX-Shortcuts: 1.2.1
    ChimeraX-ShowSequences: 1.0.3
    ChimeraX-SideView: 1.0.1
    ChimeraX-SimilarStructures: 1.0.1
    ChimeraX-Smiles: 2.1.2
    ChimeraX-SmoothLines: 1.0
    ChimeraX-SpaceNavigator: 1.0
    ChimeraX-StdCommands: 1.19.1
    ChimeraX-STL: 1.0.1
    ChimeraX-Storm: 1.0
    ChimeraX-StructMeasure: 1.2.1
    ChimeraX-Struts: 1.0.1
    ChimeraX-Surface: 1.0.1
    ChimeraX-SwapAA: 2.0.1
    ChimeraX-SwapRes: 2.5.2
    ChimeraX-TapeMeasure: 1.0
    ChimeraX-TaskManager: 1.0
    ChimeraX-Test: 1.0
    ChimeraX-Toolbar: 1.2.3
    ChimeraX-ToolshedUtils: 1.2.4
    ChimeraX-Topography: 1.0
    ChimeraX-ToQuest: 1.0
    ChimeraX-Tug: 1.0.1
    ChimeraX-UI: 1.48.2
    ChimeraX-Umap: 1.0
    ChimeraX-uniprot: 2.3.1
    ChimeraX-UnitCell: 1.0.1
    ChimeraX-ViewDock: 1.3.2
    ChimeraX-VIPERdb: 1.0
    ChimeraX-Vive: 1.1
    ChimeraX-VolumeMenu: 1.0.1
    ChimeraX-vrml: 1.0
    ChimeraX-VTK: 1.0
    ChimeraX-WavefrontOBJ: 1.0
    ChimeraX-WebCam: 1.0.2
    ChimeraX-WebServices: 1.1.5
    ChimeraX-Zone: 1.0.1
    colorama: 0.4.6
    comm: 0.2.3
    contourpy: 1.3.3
    coverage: 7.10.5
    cxservices: 1.2.3
    cycler: 0.12.1
    Cython: 3.1.3
    debugpy: 1.8.16
    decorator: 5.2.1
    docutils: 0.21.2
    executing: 2.2.0
    filelock: 3.18.0
    fonttools: 4.59.1
    funcparserlib: 2.0.0a0
    glfw: 2.9.0
    grako: 3.16.5
    h5py: 3.14.0
    html2text: 2025.4.15
    idna: 3.10
    ihm: 2.2
    imagecodecs: 2024.6.1
    imagesize: 1.4.1
    iniconfig: 2.1.0
    ipykernel: 6.30.1
    ipython: 9.4.0
    ipython_pygments_lexers: 1.1.1
    ipywidgets: 8.1.7
    jedi: 0.19.2
    Jinja2: 3.1.6
    joblib: 1.5.0
    jupyter_client: 8.6.3
    jupyter_core: 5.8.1
    jupyterlab_widgets: 3.0.15
    kiwisolver: 1.4.9
    line_profiler: 5.0.0
    llvmlite: 0.44.0
    lxml: 6.0.0
    lz4: 4.3.2
    Markdown: 3.8.2
    MarkupSafe: 3.0.2
    matplotlib: 3.10.3
    matplotlib: 3.10.1
    matplotlib-inline: 0.1.7
    msgpack: 1.1.1
    ndindex: 1.10.0
    nest-asyncio: 1.6.0
    netCDF4: 1.6.5
    networkx: 3.3
    nibabel: 5.2.0
    nptyping: 2.5.0
    numba: 0.61.2
    numexpr: 2.11.0
    numpy: 1.26.4
    OpenMM: 8.2.0
    openvr: 1.26.701
    packaging: 25.0
    ParmEd: 4.2.2
    parso: 0.8.5
    pep517: 0.13.1
    pexpect: 4.9.0
    pickleshare: 0.7.5
    pillow: 11.3.0
    pip: 25.2
    pkginfo: 1.12.1.2
    platformdirs: 4.3.8
    pluggy: 1.6.0
    prompt_toolkit: 3.0.51
    psutil: 7.0.0
    ptyprocess: 0.7.0
    pure_eval: 0.2.3
    py-cpuinfo: 9.0.0
    pybind11: 3.0.1
    pycollada: 0.8
    pydicom: 2.4.4
    Pygments: 2.18.0
    pynmrstar: 3.3.5
    pynndescent: 0.5.13
    pynrrd: 1.0.0
    PyOpenGL: 3.1.10
    PyOpenGL-accelerate: 3.1.10
    pyopenxr: 1.1.4501
    pyparsing: 3.2.3
    pyproject_hooks: 1.2.0
    PySide6: 6.9.2
    PySide6_Addons: 6.9.2
    PySide6_Essentials: 6.9.2
    pytest: 8.4.1
    pytest-cov: 6.2.1
    python-dateutil: 2.9.0.post0
    pytz: 2025.2
    pyzmq: 27.0.2
    qtconsole: 5.6.1
    QtPy: 2.4.3
    qtshim: 1.2
    RandomWords: 0.4.0
    requests: 2.32.4
    roman-numerals-py: 3.1.0
    scikit-learn: 1.6.1
    scipy: 1.14.0
    setuptools: 80.9.0
    sfftk-rw: 0.8.1
    shiboken6: 6.9.2
    six: 1.17.0
    snowballstemmer: 3.0.1
    sortedcontainers: 2.4.0
    soupsieve: 2.7
    Sphinx: 8.2.3
    sphinx-autodoc-typehints: 3.2.0
    sphinxcontrib-applehelp: 2.0.0
    sphinxcontrib-blockdiag: 3.0.0
    sphinxcontrib-devhelp: 2.0.0
    sphinxcontrib-htmlhelp: 2.1.0
    sphinxcontrib-jsmath: 1.0.1
    sphinxcontrib-qthelp: 2.0.0
    sphinxcontrib-serializinghtml: 2.0.0
    stack-data: 0.6.3
    superqt: 0.7.6
    tables: 3.10.2
    tcia_utils: 1.5.1
    threadpoolctl: 3.6.0
    tifffile: 2025.3.13
    tinyarray: 1.2.5
    tornado: 6.5.2
    tqdm: 4.67.1
    traitlets: 5.14.3
    typing_extensions: 4.15.0
    tzdata: 2025.2
    umap-learn: 0.5.7
    urllib3: 2.5.0
    wcwidth: 0.2.13
    webcolors: 24.11.1
    wheel: 0.45.1
    wheel-filename: 1.4.2
    widgetsnbextension: 4.0.14

Change History (5)

comment:1 by Tom Goddard, 11 months ago

Cc: Eric Pettersen added
Component: UnassignedWindow Toolkit
Owner: set to Zach Pearson
Platform: all
Project: ChimeraX
Status: newassigned
Summary: ChimeraX bug report submissionSequence viewer 'PySide6.QtWebEngineCore.QWebEngineUrlRequestInfo' object has no attribute 'sceneBoundingRect'

comment:2 by Eric Pettersen, 11 months ago

That variable ('text') is the return value from (QGraphicsScene).addSimpleText(...), which is supposed to return a QGraphicsSimpleTextItem, not a QWebEngineUrlRequestInfo.

comment:3 by Eric Pettersen, 11 months ago

Though I get the same error in this ticket if I try to show the chain sequence via the link in the log ("'PySide6.QtCore.QUrl.toString' called with wrong argument types"), it works for me if I use the Show Sequences tool, unlike what happened in this ticket.

comment:4 by Zach Pearson, 10 months ago

Resolution: fixed
Status: assignedclosed

I think this is fixed for the same reason #18646 is fixed. I played around with Show Sequence Viewer and the log links and didn't encounter any tracebacks.

comment:5 by Zach Pearson, 10 months ago

i.e. I think the second error is caused by the first error.

Note: See TracTickets for help on using tickets.